FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630682_at:

>probe:Drosophila_2:1630682_at:604:391; Interrogation_Position=3628; Antisense; GAAAGATTTCTTATTACCCAAGCAA
>probe:Drosophila_2:1630682_at:265:257; Interrogation_Position=3677; Antisense; CAAATTGTTCATTCGGTCCGTTTCG
>probe:Drosophila_2:1630682_at:101:293; Interrogation_Position=3695; Antisense; CGTTTCGCACTAGGCTGCCAGGGAT
>probe:Drosophila_2:1630682_at:315:267; Interrogation_Position=3713; Antisense; CAGGGATCTCAAGCCAGATCTCTTT
>probe:Drosophila_2:1630682_at:474:97; Interrogation_Position=3728; Antisense; AGATCTCTTTGGTTGCCTCTTAAAT
>probe:Drosophila_2:1630682_at:427:541; Interrogation_Position=3738; Antisense; GGTTGCCTCTTAAATATCGTATCTA
>probe:Drosophila_2:1630682_at:669:717; Interrogation_Position=3931; Antisense; TTCCGAAATCGGCACAAATCAATTC
>probe:Drosophila_2:1630682_at:608:83; Interrogation_Position=3962; Antisense; AGTGATGCTTCCTAACACCTAGTGA
>probe:Drosophila_2:1630682_at:478:185; Interrogation_Position=3975; Antisense; AACACCTAGTGATCCCCGTAAAATG
>probe:Drosophila_2:1630682_at:725:455; Interrogation_Position=4004; Antisense; GATAGGTGAACAATCCCGCTTTCCA
>probe:Drosophila_2:1630682_at:516:695; Interrogation_Position=4023; Antisense; TTTCCACTTCCATAAACTCCAGATT
>probe:Drosophila_2:1630682_at:149:31; Interrogation_Position=4034; Antisense; ATAAACTCCAGATTCACACCCAAAA
>probe:Drosophila_2:1630682_at:669:69; Interrogation_Position=4070; Antisense; AGGCCGCAAACACGCCCAAATATAT
>probe:Drosophila_2:1630682_at:264:53; Interrogation_Position=4093; Antisense; ATGCATGCACGTATATATGTCAAGC

Paste this into a BLAST search page for me
GAAAGATTTCTTATTACCCAAGCAACAAATTGTTCATTCGGTCCGTTTCGCGTTTCGCACTAGGCTGCCAGGGATCAGGGATCTCAAGCCAGATCTCTTTAGATCTCTTTGGTTGCCTCTTAAATGGTTGCCTCTTAAATATCGTATCTATTCCGAAATCGGCACAAATCAATTCAGTGATGCTTCCTAACACCTAGTGAAACACCTAGTGATCCCCGTAAAATGGATAGGTGAACAATCCCGCTTTCCATTTCCACTTCCATAAACTCCAGATTATAAACTCCAGATTCACACCCAAAAAGGCCGCAAACACGCCCAAATATATATGCATGCACGTATATATGTCAAGC

Full Affymetrix probeset data:

Annotations for 1630682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720