FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630684_at:

>probe:Drosophila_2:1630684_at:645:163; Interrogation_Position=1636; Antisense; AAATCAGCTTATGTTGCTCACCAAA
>probe:Drosophila_2:1630684_at:306:179; Interrogation_Position=1659; Antisense; AAACTCTAGGAGATCGTCTGGAGAC
>probe:Drosophila_2:1630684_at:715:663; Interrogation_Position=1728; Antisense; TAAAGGCCCGTATCAGCCGACTGGA
>probe:Drosophila_2:1630684_at:45:227; Interrogation_Position=1775; Antisense; AAGGAACTCGATGTGCAGTCCGATA
>probe:Drosophila_2:1630684_at:226:297; Interrogation_Position=1847; Antisense; CGCACTTCTCTTAACGGATCGATTG
>probe:Drosophila_2:1630684_at:18:3; Interrogation_Position=1868; Antisense; ATTGGTTCCTTCTGCTTCGAAAATC
>probe:Drosophila_2:1630684_at:159:635; Interrogation_Position=1884; Antisense; TCGAAAATCAGTCCCAGTACCAGTC
>probe:Drosophila_2:1630684_at:223:487; Interrogation_Position=1900; Antisense; GTACCAGTCCACAAATACGCTGAAT
>probe:Drosophila_2:1630684_at:303:349; Interrogation_Position=1928; Antisense; GCAGGACAGCCTGAGCCCAGAATAG
>probe:Drosophila_2:1630684_at:208:379; Interrogation_Position=2008; Antisense; GAAGCTGGAGTATATCACCGAGGAG
>probe:Drosophila_2:1630684_at:459:447; Interrogation_Position=2042; Antisense; GATGCCAAATTTTTCGAGGACACCA
>probe:Drosophila_2:1630684_at:393:437; Interrogation_Position=2057; Antisense; GAGGACACCATCAACAGTACGAAGA
>probe:Drosophila_2:1630684_at:221:391; Interrogation_Position=2093; Antisense; GAAACTGTACTTGGAGCTCGCGAAA
>probe:Drosophila_2:1630684_at:462:113; Interrogation_Position=2153; Antisense; AGCACGAGCGAGACTTCCATTCAAT

Paste this into a BLAST search page for me
AAATCAGCTTATGTTGCTCACCAAAAAACTCTAGGAGATCGTCTGGAGACTAAAGGCCCGTATCAGCCGACTGGAAAGGAACTCGATGTGCAGTCCGATACGCACTTCTCTTAACGGATCGATTGATTGGTTCCTTCTGCTTCGAAAATCTCGAAAATCAGTCCCAGTACCAGTCGTACCAGTCCACAAATACGCTGAATGCAGGACAGCCTGAGCCCAGAATAGGAAGCTGGAGTATATCACCGAGGAGGATGCCAAATTTTTCGAGGACACCAGAGGACACCATCAACAGTACGAAGAGAAACTGTACTTGGAGCTCGCGAAAAGCACGAGCGAGACTTCCATTCAAT

Full Affymetrix probeset data:

Annotations for 1630684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720