FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630685_at:

>probe:Drosophila_2:1630685_at:512:357; Interrogation_Position=1009; Antisense; GCACACTGAAGACTACACGCTGGAC
>probe:Drosophila_2:1630685_at:545:665; Interrogation_Position=1022; Antisense; TACACGCTGGACGTCGACCTACAGT
>probe:Drosophila_2:1630685_at:619:413; Interrogation_Position=1037; Antisense; GACCTACAGTTCACCATTCTAGAGG
>probe:Drosophila_2:1630685_at:336:321; Interrogation_Position=1078; Antisense; GCCCATATCGCCTAATCCTAATGAG
>probe:Drosophila_2:1630685_at:587:55; Interrogation_Position=1098; Antisense; ATGAGGGCACCTTTCGCGAAGACGA
>probe:Drosophila_2:1630685_at:69:653; Interrogation_Position=1173; Antisense; TTATTGGGAACTCAGAAGGGCCTCA
>probe:Drosophila_2:1630685_at:66:385; Interrogation_Position=1201; Antisense; GAACTAAACGCAGTCTATCACAATG
>probe:Drosophila_2:1630685_at:397:589; Interrogation_Position=1308; Antisense; TGGATCACTTTGTACTTGGACGAAA
>probe:Drosophila_2:1630685_at:122:105; Interrogation_Position=849; Antisense; AGACGCCTTTGTTGGTATCCGTGAA
>probe:Drosophila_2:1630685_at:58:627; Interrogation_Position=897; Antisense; TGCCACGTCGGCAGATGATTCAGAC
>probe:Drosophila_2:1630685_at:681:603; Interrogation_Position=912; Antisense; TGATTCAGACCTGTCAAGGCTCGGA
>probe:Drosophila_2:1630685_at:336:251; Interrogation_Position=926; Antisense; CAAGGCTCGGAGACCCTGAAGAATT
>probe:Drosophila_2:1630685_at:289:247; Interrogation_Position=947; Antisense; AATTGCGATCTGCTTTCGGACAGTC
>probe:Drosophila_2:1630685_at:113:641; Interrogation_Position=962; Antisense; TCGGACAGTCCGCATTTTATGCGAT

Paste this into a BLAST search page for me
GCACACTGAAGACTACACGCTGGACTACACGCTGGACGTCGACCTACAGTGACCTACAGTTCACCATTCTAGAGGGCCCATATCGCCTAATCCTAATGAGATGAGGGCACCTTTCGCGAAGACGATTATTGGGAACTCAGAAGGGCCTCAGAACTAAACGCAGTCTATCACAATGTGGATCACTTTGTACTTGGACGAAAAGACGCCTTTGTTGGTATCCGTGAATGCCACGTCGGCAGATGATTCAGACTGATTCAGACCTGTCAAGGCTCGGACAAGGCTCGGAGACCCTGAAGAATTAATTGCGATCTGCTTTCGGACAGTCTCGGACAGTCCGCATTTTATGCGAT

Full Affymetrix probeset data:

Annotations for 1630685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720