Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630686_at:

>probe:Drosophila_2:1630686_at:664:301; Interrogation_Position=3867; Antisense; CCCGTGCTCCATGCGGTATGCAAAT
>probe:Drosophila_2:1630686_at:294:685; Interrogation_Position=3918; Antisense; TATCAATGACTAAAACGTGCTTCGT
>probe:Drosophila_2:1630686_at:528:137; Interrogation_Position=3932; Antisense; ACGTGCTTCGTTTTCTTAATCGCTA
>probe:Drosophila_2:1630686_at:417:233; Interrogation_Position=3984; Antisense; AATGCTTAAAGCTTGACCTGGACAA
>probe:Drosophila_2:1630686_at:504:675; Interrogation_Position=4046; Antisense; TAGGACCCAAATGTGCATACTATGT
>probe:Drosophila_2:1630686_at:627:681; Interrogation_Position=4066; Antisense; TATGTGCATGCTCATAGCCCTTAGC
>probe:Drosophila_2:1630686_at:709:673; Interrogation_Position=4080; Antisense; TAGCCCTTAGCCTATGTAATCAAGT
>probe:Drosophila_2:1630686_at:701:17; Interrogation_Position=4112; Antisense; ATTTACACCTCTACATACATTTATA
>probe:Drosophila_2:1630686_at:447:207; Interrogation_Position=4197; Antisense; AAGCTGAGCGTCTATTTTTTATGAT
>probe:Drosophila_2:1630686_at:624:217; Interrogation_Position=4264; Antisense; AAGTGCAAATGCTTCTTAGGAATTT
>probe:Drosophila_2:1630686_at:585:675; Interrogation_Position=4318; Antisense; TATTTTATACATTGTGCCCCGTTGA
>probe:Drosophila_2:1630686_at:48:727; Interrogation_Position=4329; Antisense; TTGTGCCCCGTTGATTGTAAATGAA
>probe:Drosophila_2:1630686_at:14:393; Interrogation_Position=4351; Antisense; GAAATTTATTGTCTGTCCTGTTGTG
>probe:Drosophila_2:1630686_at:496:501; Interrogation_Position=4365; Antisense; GTCCTGTTGTGTTCTTTGTAACTAC

Paste this into a BLAST search page for me
CCCGTGCTCCATGCGGTATGCAAATTATCAATGACTAAAACGTGCTTCGTACGTGCTTCGTTTTCTTAATCGCTAAATGCTTAAAGCTTGACCTGGACAATAGGACCCAAATGTGCATACTATGTTATGTGCATGCTCATAGCCCTTAGCTAGCCCTTAGCCTATGTAATCAAGTATTTACACCTCTACATACATTTATAAAGCTGAGCGTCTATTTTTTATGATAAGTGCAAATGCTTCTTAGGAATTTTATTTTATACATTGTGCCCCGTTGATTGTGCCCCGTTGATTGTAAATGAAGAAATTTATTGTCTGTCCTGTTGTGGTCCTGTTGTGTTCTTTGTAACTAC

Full Affymetrix probeset data:

Annotations for 1630686_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime