Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630688_at:

>probe:Drosophila_2:1630688_at:711:621; Interrogation_Position=2320; Antisense; TGCTGTCCTCTGGATTCTCGCTGGA
>probe:Drosophila_2:1630688_at:184:645; Interrogation_Position=2371; Antisense; TCTACCGCATGATCAAGCTGGGCTT
>probe:Drosophila_2:1630688_at:348:555; Interrogation_Position=2408; Antisense; GGACGAGCCTATGACTACCGACGAT
>probe:Drosophila_2:1630688_at:119:295; Interrogation_Position=2426; Antisense; CGACGATGCCCAGAGCGCCGGAGAT
>probe:Drosophila_2:1630688_at:316:607; Interrogation_Position=2465; Antisense; TGAGGACACAGAGGACGCTTCCCAC
>probe:Drosophila_2:1630688_at:446:341; Interrogation_Position=2481; Antisense; GCTTCCCACATGGAGGAGGTCGATT
>probe:Drosophila_2:1630688_at:676:243; Interrogation_Position=2533; Antisense; AATTCATTCTATCACTCGCATTCAC
>probe:Drosophila_2:1630688_at:88:255; Interrogation_Position=2561; Antisense; CACAATTTACTTGCGTTTCGAACTT
>probe:Drosophila_2:1630688_at:578:673; Interrogation_Position=2587; Antisense; TATACTGAGTTTACTACGGCCGAGT
>probe:Drosophila_2:1630688_at:722:481; Interrogation_Position=2620; Antisense; GTATTCATTAACATTTTGCCGCGTT
>probe:Drosophila_2:1630688_at:70:401; Interrogation_Position=2651; Antisense; GACAGACATACGCTTAACTCATAAA
>probe:Drosophila_2:1630688_at:533:179; Interrogation_Position=2779; Antisense; AACTAAAGACTACATACGCGCCCTA
>probe:Drosophila_2:1630688_at:611:669; Interrogation_Position=2793; Antisense; TACGCGCCCTAGTTGGTAGAGCTAT
>probe:Drosophila_2:1630688_at:568:221; Interrogation_Position=2844; Antisense; AAGGTTTGATGACCCGATCGATGAT

Paste this into a BLAST search page for me
TGCTGTCCTCTGGATTCTCGCTGGATCTACCGCATGATCAAGCTGGGCTTGGACGAGCCTATGACTACCGACGATCGACGATGCCCAGAGCGCCGGAGATTGAGGACACAGAGGACGCTTCCCACGCTTCCCACATGGAGGAGGTCGATTAATTCATTCTATCACTCGCATTCACCACAATTTACTTGCGTTTCGAACTTTATACTGAGTTTACTACGGCCGAGTGTATTCATTAACATTTTGCCGCGTTGACAGACATACGCTTAACTCATAAAAACTAAAGACTACATACGCGCCCTATACGCGCCCTAGTTGGTAGAGCTATAAGGTTTGATGACCCGATCGATGAT

Full Affymetrix probeset data:

Annotations for 1630688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime