FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630689_at:

>probe:Drosophila_2:1630689_at:218:55; Interrogation_Position=13; Antisense; ATGAATGCTCGGCTGATCCTGAGGC
>probe:Drosophila_2:1630689_at:186:621; Interrogation_Position=194; Antisense; TGCTGCTGAACTACGCTGGCGATAT
>probe:Drosophila_2:1630689_at:66:583; Interrogation_Position=210; Antisense; TGGCGATATACTGGGCAACCTGCTC
>probe:Drosophila_2:1630689_at:191:273; Interrogation_Position=234; Antisense; CTTGGGTAGTCTTCCATTGGAGCCA
>probe:Drosophila_2:1630689_at:517:553; Interrogation_Position=252; Antisense; GGAGCCACTGTGCAATACCGCAGAT
>probe:Drosophila_2:1630689_at:646:265; Interrogation_Position=272; Antisense; CAGATGTCATGCTCAGTTCGTTGAT
>probe:Drosophila_2:1630689_at:568:471; Interrogation_Position=287; Antisense; GTTCGTTGATCTGGTACTGCATCTT
>probe:Drosophila_2:1630689_at:49:145; Interrogation_Position=302; Antisense; ACTGCATCTTTTACTGTCCCTTTGA
>probe:Drosophila_2:1630689_at:567:299; Interrogation_Position=375; Antisense; CGCCATGTCTACGATTAGCCAGGTT
>probe:Drosophila_2:1630689_at:390:19; Interrogation_Position=422; Antisense; ATTTGGCGGCACAGGTCTACGGAAA
>probe:Drosophila_2:1630689_at:696:165; Interrogation_Position=444; Antisense; AAATGCTCCAATCCCGATGCTAGTG
>probe:Drosophila_2:1630689_at:366:249; Interrogation_Position=45; Antisense; CAATCACTTGATCTTTCGCATCCTG
>probe:Drosophila_2:1630689_at:293:447; Interrogation_Position=459; Antisense; GATGCTAGTGGTTGGCACCGTCATG
>probe:Drosophila_2:1630689_at:138:343; Interrogation_Position=500; Antisense; TACTGAAACCGGTGGCGAGTCTTTT

Paste this into a BLAST search page for me
ATGAATGCTCGGCTGATCCTGAGGCTGCTGCTGAACTACGCTGGCGATATTGGCGATATACTGGGCAACCTGCTCCTTGGGTAGTCTTCCATTGGAGCCAGGAGCCACTGTGCAATACCGCAGATCAGATGTCATGCTCAGTTCGTTGATGTTCGTTGATCTGGTACTGCATCTTACTGCATCTTTTACTGTCCCTTTGACGCCATGTCTACGATTAGCCAGGTTATTTGGCGGCACAGGTCTACGGAAAAAATGCTCCAATCCCGATGCTAGTGCAATCACTTGATCTTTCGCATCCTGGATGCTAGTGGTTGGCACCGTCATGTACTGAAACCGGTGGCGAGTCTTTT

Full Affymetrix probeset data:

Annotations for 1630689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720