FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630690_at:

>probe:Drosophila_2:1630690_at:719:9; Interrogation_Position=127; Antisense; ATTCCGCAGCCAATTGCCGTTCAAA
>probe:Drosophila_2:1630690_at:165:365; Interrogation_Position=211; Antisense; GAATATTTCCATAGAGTGCCCGACT
>probe:Drosophila_2:1630690_at:426:463; Interrogation_Position=240; Antisense; GATTCTATATACTTTTCGTGTCGTA
>probe:Drosophila_2:1630690_at:178:635; Interrogation_Position=255; Antisense; TCGTGTCGTAAAGTTGGCTCCAGCT
>probe:Drosophila_2:1630690_at:604:571; Interrogation_Position=270; Antisense; GGCTCCAGCTTTTACCATCAATATA
>probe:Drosophila_2:1630690_at:636:621; Interrogation_Position=352; Antisense; TGCGAATTTCTTAACAATCCTGTGA
>probe:Drosophila_2:1630690_at:130:149; Interrogation_Position=406; Antisense; ACTTTGGTGGTCAACGGCAGTTACT
>probe:Drosophila_2:1630690_at:420:567; Interrogation_Position=421; Antisense; GGCAGTTACTTCAAGTGTCCTATCA
>probe:Drosophila_2:1630690_at:227:517; Interrogation_Position=435; Antisense; GTGTCCTATCAAGCCAAATGTTTAC
>probe:Drosophila_2:1630690_at:64:627; Interrogation_Position=46; Antisense; TGCCTATTTGGCTTACTGTTTTTCG
>probe:Drosophila_2:1630690_at:403:31; Interrogation_Position=478; Antisense; ATAATGTCCATGATACCAAGCGTTC
>probe:Drosophila_2:1630690_at:8:649; Interrogation_Position=501; Antisense; TCATCCATTTGGTCGCTTTCAGCTA
>probe:Drosophila_2:1630690_at:20:343; Interrogation_Position=515; Antisense; GCTTTCAGCTATCAATGCGTGTAAA
>probe:Drosophila_2:1630690_at:325:509; Interrogation_Position=546; Antisense; GGAAAGTCGTAAGCCGTTTGTTATG

Paste this into a BLAST search page for me
ATTCCGCAGCCAATTGCCGTTCAAAGAATATTTCCATAGAGTGCCCGACTGATTCTATATACTTTTCGTGTCGTATCGTGTCGTAAAGTTGGCTCCAGCTGGCTCCAGCTTTTACCATCAATATATGCGAATTTCTTAACAATCCTGTGAACTTTGGTGGTCAACGGCAGTTACTGGCAGTTACTTCAAGTGTCCTATCAGTGTCCTATCAAGCCAAATGTTTACTGCCTATTTGGCTTACTGTTTTTCGATAATGTCCATGATACCAAGCGTTCTCATCCATTTGGTCGCTTTCAGCTAGCTTTCAGCTATCAATGCGTGTAAAGGAAAGTCGTAAGCCGTTTGTTATG

Full Affymetrix probeset data:

Annotations for 1630690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720