Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630692_at:

>probe:Drosophila_2:1630692_at:712:349; Interrogation_Position=101; Antisense; GCAGTAAGTTGGTCAGCACTCAGAA
>probe:Drosophila_2:1630692_at:189:355; Interrogation_Position=116; Antisense; GCACTCAGAACGTGACCATCTACAA
>probe:Drosophila_2:1630692_at:560:53; Interrogation_Position=13; Antisense; ATGAAGGCCTTGCAATTCGCTCTTG
>probe:Drosophila_2:1630692_at:374:371; Interrogation_Position=141; Antisense; GAAGGCCAACCAATATGTGAGCAGT
>probe:Drosophila_2:1630692_at:693:595; Interrogation_Position=156; Antisense; TGTGAGCAGTCTCATCAGTTTCCCA
>probe:Drosophila_2:1630692_at:411:583; Interrogation_Position=182; Antisense; TGGCGGGCCAGAGCAACACTAAAAC
>probe:Drosophila_2:1630692_at:124:247; Interrogation_Position=26; Antisense; AATTCGCTCTTGTATTTTCGGCCAT
>probe:Drosophila_2:1630692_at:44:535; Interrogation_Position=269; Antisense; GGTCCGGTGGACCAGGATTCATCAA
>probe:Drosophila_2:1630692_at:110:543; Interrogation_Position=283; Antisense; GGATTCATCAATGCCCAGGTCAATG
>probe:Drosophila_2:1630692_at:111:231; Interrogation_Position=304; Antisense; AATGTCACAAGCCAGTTTTCTCAAG
>probe:Drosophila_2:1630692_at:1:145; Interrogation_Position=340; Antisense; ACTGCTCAATTTTGGGTGGATGCCT
>probe:Drosophila_2:1630692_at:373:517; Interrogation_Position=355; Antisense; GTGGATGCCTAAACCTACAACTTTT
>probe:Drosophila_2:1630692_at:488:7; Interrogation_Position=58; Antisense; ATTGCCTTCGCTGCAAATGCCAGTT
>probe:Drosophila_2:1630692_at:27:415; Interrogation_Position=86; Antisense; GAGCCAAATTGTCCAGCAGTAAGTT

Paste this into a BLAST search page for me
GCAGTAAGTTGGTCAGCACTCAGAAGCACTCAGAACGTGACCATCTACAAATGAAGGCCTTGCAATTCGCTCTTGGAAGGCCAACCAATATGTGAGCAGTTGTGAGCAGTCTCATCAGTTTCCCATGGCGGGCCAGAGCAACACTAAAACAATTCGCTCTTGTATTTTCGGCCATGGTCCGGTGGACCAGGATTCATCAAGGATTCATCAATGCCCAGGTCAATGAATGTCACAAGCCAGTTTTCTCAAGACTGCTCAATTTTGGGTGGATGCCTGTGGATGCCTAAACCTACAACTTTTATTGCCTTCGCTGCAAATGCCAGTTGAGCCAAATTGTCCAGCAGTAAGTT

Full Affymetrix probeset data:

Annotations for 1630692_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime