Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630694_at:

>probe:Drosophila_2:1630694_at:659:283; Interrogation_Position=3232; Antisense; CTGGAGACCCAAATGCTGGCCGCGG
>probe:Drosophila_2:1630694_at:384:281; Interrogation_Position=3428; Antisense; CTCTGGCATCGGGTCAAGGGTCACA
>probe:Drosophila_2:1630694_at:642:219; Interrogation_Position=3443; Antisense; AAGGGTCACAGGGTCACAGACTTAG
>probe:Drosophila_2:1630694_at:530:467; Interrogation_Position=3483; Antisense; GTTGTTGGTTATACTCTTGCTGTGC
>probe:Drosophila_2:1630694_at:393:275; Interrogation_Position=3498; Antisense; CTTGCTGTGCTTGATGCTGGCATTA
>probe:Drosophila_2:1630694_at:379:687; Interrogation_Position=3533; Antisense; TATTACTTAAGCTCTGGAGGCTGGA
>probe:Drosophila_2:1630694_at:708:703; Interrogation_Position=3566; Antisense; TTGACGTGGATCTCAATCGGCGGGC
>probe:Drosophila_2:1630694_at:409:347; Interrogation_Position=3593; Antisense; GCATGCCCAGTTTGGCGGCCTTGAG
>probe:Drosophila_2:1630694_at:637:273; Interrogation_Position=3612; Antisense; CTTGAGTGAGCTGCCGAGCACGAAT
>probe:Drosophila_2:1630694_at:214:371; Interrogation_Position=3640; Antisense; GAATGGCTGGAATTGCTGCGAGACC
>probe:Drosophila_2:1630694_at:120:81; Interrogation_Position=3704; Antisense; AGGTGCTCCAAACTGCCATCGAGCT
>probe:Drosophila_2:1630694_at:83:345; Interrogation_Position=3743; Antisense; GCATTGTCTGCGAAAAGATCACCAA
>probe:Drosophila_2:1630694_at:302:97; Interrogation_Position=3758; Antisense; AGATCACCAATGATAGCCACCTGCG
>probe:Drosophila_2:1630694_at:488:673; Interrogation_Position=3771; Antisense; TAGCCACCTGCGTCAGAGCATTGAG

Paste this into a BLAST search page for me
CTGGAGACCCAAATGCTGGCCGCGGCTCTGGCATCGGGTCAAGGGTCACAAAGGGTCACAGGGTCACAGACTTAGGTTGTTGGTTATACTCTTGCTGTGCCTTGCTGTGCTTGATGCTGGCATTATATTACTTAAGCTCTGGAGGCTGGATTGACGTGGATCTCAATCGGCGGGCGCATGCCCAGTTTGGCGGCCTTGAGCTTGAGTGAGCTGCCGAGCACGAATGAATGGCTGGAATTGCTGCGAGACCAGGTGCTCCAAACTGCCATCGAGCTGCATTGTCTGCGAAAAGATCACCAAAGATCACCAATGATAGCCACCTGCGTAGCCACCTGCGTCAGAGCATTGAG

Full Affymetrix probeset data:

Annotations for 1630694_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime