Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630695_at:

>probe:Drosophila_2:1630695_at:558:593; Interrogation_Position=1024; Antisense; TGGGATCTTCGAAAGCAGCAGCCGT
>probe:Drosophila_2:1630695_at:29:353; Interrogation_Position=1038; Antisense; GCAGCAGCCGTACGATGCCTATAAT
>probe:Drosophila_2:1630695_at:59:663; Interrogation_Position=1067; Antisense; TAAACTTTGATGTTCCCATCGGCAC
>probe:Drosophila_2:1630695_at:707:527; Interrogation_Position=1097; Antisense; GGGACTGCTACGACCGATATCTTTG
>probe:Drosophila_2:1630695_at:448:691; Interrogation_Position=1118; Antisense; TTTGCCGGGTCGAGGAAATGCGCCA
>probe:Drosophila_2:1630695_at:289:395; Interrogation_Position=1132; Antisense; GAAATGCGCCAGTCATTACGAATTA
>probe:Drosophila_2:1630695_at:440:233; Interrogation_Position=1163; Antisense; AATGCCTAAACCAAATGCCTGCTGG
>probe:Drosophila_2:1630695_at:333:589; Interrogation_Position=1250; Antisense; TGGAGGCACTTATTCACCACTTCAA
>probe:Drosophila_2:1630695_at:39:689; Interrogation_Position=1359; Antisense; TATATCAGATGGGTCCAGTCGTCCA
>probe:Drosophila_2:1630695_at:130:267; Interrogation_Position=1374; Antisense; CAGTCGTCCATACCGGTGCAAAATC
>probe:Drosophila_2:1630695_at:629:31; Interrogation_Position=1396; Antisense; ATCAAAGCTCCAGGGTTTGCTCACT
>probe:Drosophila_2:1630695_at:73:477; Interrogation_Position=1410; Antisense; GTTTGCTCACTTGGCAGCTTTAGAG
>probe:Drosophila_2:1630695_at:199:53; Interrogation_Position=1453; Antisense; ATGCTAGCCGACGTCGTTGCAATAA
>probe:Drosophila_2:1630695_at:203:371; Interrogation_Position=1530; Antisense; GAATGTGTGTCTTCTCTGTACGAAA

Paste this into a BLAST search page for me
TGGGATCTTCGAAAGCAGCAGCCGTGCAGCAGCCGTACGATGCCTATAATTAAACTTTGATGTTCCCATCGGCACGGGACTGCTACGACCGATATCTTTGTTTGCCGGGTCGAGGAAATGCGCCAGAAATGCGCCAGTCATTACGAATTAAATGCCTAAACCAAATGCCTGCTGGTGGAGGCACTTATTCACCACTTCAATATATCAGATGGGTCCAGTCGTCCACAGTCGTCCATACCGGTGCAAAATCATCAAAGCTCCAGGGTTTGCTCACTGTTTGCTCACTTGGCAGCTTTAGAGATGCTAGCCGACGTCGTTGCAATAAGAATGTGTGTCTTCTCTGTACGAAA

Full Affymetrix probeset data:

Annotations for 1630695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime