Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630698_at:

>probe:Drosophila_2:1630698_at:364:307; Interrogation_Position=1018; Antisense; CCATCTCGGCGGATCATGATCTGTA
>probe:Drosophila_2:1630698_at:494:111; Interrogation_Position=1083; Antisense; AGCAATGCGTACTACTTTGCCTGCT
>probe:Drosophila_2:1630698_at:726:355; Interrogation_Position=1134; Antisense; GCACTCTACTACTGGCTGGATGACA
>probe:Drosophila_2:1630698_at:86:613; Interrogation_Position=1154; Antisense; TGACAAGAAGATGTACCGCCCCGTG
>probe:Drosophila_2:1630698_at:1:583; Interrogation_Position=1202; Antisense; TGGCGTCAAGCACTACACCTTCGAG
>probe:Drosophila_2:1630698_at:220:79; Interrogation_Position=1231; Antisense; AGGATTGTATCTATCACGCTCTCGA
>probe:Drosophila_2:1630698_at:37:625; Interrogation_Position=1262; Antisense; TGCGCGCCTCGTTTTTATTTCATAG
>probe:Drosophila_2:1630698_at:524:449; Interrogation_Position=779; Antisense; GATCCGCAGCATGGCTGGCTGGAAT
>probe:Drosophila_2:1630698_at:184:225; Interrogation_Position=803; Antisense; TAAGGACTACAAGCCGGGTCCGTAT
>probe:Drosophila_2:1630698_at:487:371; Interrogation_Position=863; Antisense; GAAGTACTATCTGTTGCCGGAGGAG
>probe:Drosophila_2:1630698_at:176:65; Interrogation_Position=907; Antisense; ATGGTCTGGGCTACGGAGATTATCC
>probe:Drosophila_2:1630698_at:28:225; Interrogation_Position=963; Antisense; AAGGACTCGTACTATCCCTGGGACT
>probe:Drosophila_2:1630698_at:326:45; Interrogation_Position=976; Antisense; ATCCCTGGGACTATCCGGAGCACAA
>probe:Drosophila_2:1630698_at:179:553; Interrogation_Position=992; Antisense; GGAGCACAAGCGCAACCAACACGAG

Paste this into a BLAST search page for me
CCATCTCGGCGGATCATGATCTGTAAGCAATGCGTACTACTTTGCCTGCTGCACTCTACTACTGGCTGGATGACATGACAAGAAGATGTACCGCCCCGTGTGGCGTCAAGCACTACACCTTCGAGAGGATTGTATCTATCACGCTCTCGATGCGCGCCTCGTTTTTATTTCATAGGATCCGCAGCATGGCTGGCTGGAATTAAGGACTACAAGCCGGGTCCGTATGAAGTACTATCTGTTGCCGGAGGAGATGGTCTGGGCTACGGAGATTATCCAAGGACTCGTACTATCCCTGGGACTATCCCTGGGACTATCCGGAGCACAAGGAGCACAAGCGCAACCAACACGAG

Full Affymetrix probeset data:

Annotations for 1630698_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime