Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630699_at:

>probe:Drosophila_2:1630699_at:243:655; Interrogation_Position=2960; Antisense; TAATTTTGTTCCCATTTTCTGTCGG
>probe:Drosophila_2:1630699_at:507:631; Interrogation_Position=2969; Antisense; TCCCATTTTCTGTCGGTATTCCAAA
>probe:Drosophila_2:1630699_at:610:481; Interrogation_Position=2984; Antisense; GTATTCCAAAAAATCTCTCCTTCGC
>probe:Drosophila_2:1630699_at:149:545; Interrogation_Position=3029; Antisense; GGATAGCTGATATTCGGTTAACTCG
>probe:Drosophila_2:1630699_at:154:363; Interrogation_Position=3095; Antisense; GAATTACGAGTTCACGAAGACATTA
>probe:Drosophila_2:1630699_at:151:481; Interrogation_Position=3153; Antisense; GTATTAGCCCCGTTCAGAAATAACA
>probe:Drosophila_2:1630699_at:176:191; Interrogation_Position=3174; Antisense; AACATTCCAATTCCAAGACTGGTCA
>probe:Drosophila_2:1630699_at:392:407; Interrogation_Position=3190; Antisense; GACTGGTCACAACAATAGCACTATT
>probe:Drosophila_2:1630699_at:468:181; Interrogation_Position=3291; Antisense; AAAACTCGTGTATATCTACGCTAAA
>probe:Drosophila_2:1630699_at:651:249; Interrogation_Position=3359; Antisense; CAAAGTTAGCTTTCAGTTTTCGTAT
>probe:Drosophila_2:1630699_at:241:647; Interrogation_Position=3371; Antisense; TCAGTTTTCGTATTGGACAGCTCCT
>probe:Drosophila_2:1630699_at:359:399; Interrogation_Position=3386; Antisense; GACAGCTCCTTTCAGCGATTGTATT
>probe:Drosophila_2:1630699_at:11:401; Interrogation_Position=3438; Antisense; GACATCGTTTACATTAATCCGCTTG
>probe:Drosophila_2:1630699_at:616:25; Interrogation_Position=3469; Antisense; ATAGATGACTACTGGCAAATCGGAA

Paste this into a BLAST search page for me
TAATTTTGTTCCCATTTTCTGTCGGTCCCATTTTCTGTCGGTATTCCAAAGTATTCCAAAAAATCTCTCCTTCGCGGATAGCTGATATTCGGTTAACTCGGAATTACGAGTTCACGAAGACATTAGTATTAGCCCCGTTCAGAAATAACAAACATTCCAATTCCAAGACTGGTCAGACTGGTCACAACAATAGCACTATTAAAACTCGTGTATATCTACGCTAAACAAAGTTAGCTTTCAGTTTTCGTATTCAGTTTTCGTATTGGACAGCTCCTGACAGCTCCTTTCAGCGATTGTATTGACATCGTTTACATTAATCCGCTTGATAGATGACTACTGGCAAATCGGAA

Full Affymetrix probeset data:

Annotations for 1630699_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime