FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630701_at:

>probe:Drosophila_2:1630701_at:531:503; Interrogation_Position=1027; Antisense; GTCCCTTCGATTTCCACATGATGAT
>probe:Drosophila_2:1630701_at:669:95; Interrogation_Position=1110; Antisense; AGATGCTACTGTTTTCCGGCCTATG
>probe:Drosophila_2:1630701_at:150:71; Interrogation_Position=1140; Antisense; AGGCTATCCGCCTTTCAATATATGT
>probe:Drosophila_2:1630701_at:146:507; Interrogation_Position=1163; Antisense; GTGCCGTTGGAGATTTCATCACCTA
>probe:Drosophila_2:1630701_at:98:679; Interrogation_Position=1241; Antisense; TAGATTGTTTTCACTTTCGGTCGTA
>probe:Drosophila_2:1630701_at:395:221; Interrogation_Position=1268; Antisense; AAGTGTTTGCCTTCCATTTGATAAG
>probe:Drosophila_2:1630701_at:730:571; Interrogation_Position=731; Antisense; GGCTAAGCGACTTCATGATGTGGCA
>probe:Drosophila_2:1630701_at:530:209; Interrogation_Position=759; Antisense; AAGCACATCCGTGTTGTACTTCAGC
>probe:Drosophila_2:1630701_at:612:727; Interrogation_Position=772; Antisense; TTGTACTTCAGCAACGTCCTGTGGC
>probe:Drosophila_2:1630701_at:341:97; Interrogation_Position=800; Antisense; AGATCACTTTCTGGCATTTCCTGGC
>probe:Drosophila_2:1630701_at:638:77; Interrogation_Position=883; Antisense; AGGATGCAGAGCTGCCAGCTGGCCA
>probe:Drosophila_2:1630701_at:117:227; Interrogation_Position=907; Antisense; AAGGCGACTGACTTCTACAGCGAAC
>probe:Drosophila_2:1630701_at:504:113; Interrogation_Position=925; Antisense; AGCGAACGCGTCCAGAATTTCCTGA
>probe:Drosophila_2:1630701_at:231:41; Interrogation_Position=965; Antisense; ATCGGCGGAAGCTGCTTGTGCGACT

Paste this into a BLAST search page for me
GTCCCTTCGATTTCCACATGATGATAGATGCTACTGTTTTCCGGCCTATGAGGCTATCCGCCTTTCAATATATGTGTGCCGTTGGAGATTTCATCACCTATAGATTGTTTTCACTTTCGGTCGTAAAGTGTTTGCCTTCCATTTGATAAGGGCTAAGCGACTTCATGATGTGGCAAAGCACATCCGTGTTGTACTTCAGCTTGTACTTCAGCAACGTCCTGTGGCAGATCACTTTCTGGCATTTCCTGGCAGGATGCAGAGCTGCCAGCTGGCCAAAGGCGACTGACTTCTACAGCGAACAGCGAACGCGTCCAGAATTTCCTGAATCGGCGGAAGCTGCTTGTGCGACT

Full Affymetrix probeset data:

Annotations for 1630701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720