Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630702_at:

>probe:Drosophila_2:1630702_at:203:609; Interrogation_Position=1334; Antisense; TGAGCAACACGCAGCTGGAGCGCAA
>probe:Drosophila_2:1630702_at:144:179; Interrogation_Position=1357; Antisense; AAACTGAGGCTCTGCGGTGAGCTCT
>probe:Drosophila_2:1630702_at:502:609; Interrogation_Position=1374; Antisense; TGAGCTCTACAACGTATGCCGGCGA
>probe:Drosophila_2:1630702_at:193:683; Interrogation_Position=1388; Antisense; TATGCCGGCGACTGGATCCATATAG
>probe:Drosophila_2:1630702_at:467:207; Interrogation_Position=1417; Antisense; AAGCTGGCTATCTATGTCACGGTCA
>probe:Drosophila_2:1630702_at:252:61; Interrogation_Position=1430; Antisense; ATGTCACGGTCATCCTGATCGAGGT
>probe:Drosophila_2:1630702_at:458:115; Interrogation_Position=1472; Antisense; AGCAGGCACGAAGGGCACCAGCAGA
>probe:Drosophila_2:1630702_at:156:369; Interrogation_Position=1495; Antisense; GAAGGAACTTCCCTCTTGGGTCTTG
>probe:Drosophila_2:1630702_at:108:727; Interrogation_Position=1510; Antisense; TTGGGTCTTGCGCAAAGCCGTCTTA
>probe:Drosophila_2:1630702_at:637:173; Interrogation_Position=1523; Antisense; AAAGCCGTCTTAGGGAAGCGCATAT
>probe:Drosophila_2:1630702_at:379:385; Interrogation_Position=1710; Antisense; GAACATTTTGAACACCGGATGCTGT
>probe:Drosophila_2:1630702_at:670:303; Interrogation_Position=1724; Antisense; CCGGATGCTGTTAGGTGCTGTTAAA
>probe:Drosophila_2:1630702_at:62:475; Interrogation_Position=1763; Antisense; GTTAAAATCCAATGAAGCGCCGTTC
>probe:Drosophila_2:1630702_at:425:157; Interrogation_Position=1828; Antisense; ACACATTTTTGTTGGGTTGCTTATA

Paste this into a BLAST search page for me
TGAGCAACACGCAGCTGGAGCGCAAAAACTGAGGCTCTGCGGTGAGCTCTTGAGCTCTACAACGTATGCCGGCGATATGCCGGCGACTGGATCCATATAGAAGCTGGCTATCTATGTCACGGTCAATGTCACGGTCATCCTGATCGAGGTAGCAGGCACGAAGGGCACCAGCAGAGAAGGAACTTCCCTCTTGGGTCTTGTTGGGTCTTGCGCAAAGCCGTCTTAAAAGCCGTCTTAGGGAAGCGCATATGAACATTTTGAACACCGGATGCTGTCCGGATGCTGTTAGGTGCTGTTAAAGTTAAAATCCAATGAAGCGCCGTTCACACATTTTTGTTGGGTTGCTTATA

Full Affymetrix probeset data:

Annotations for 1630702_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime