FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630703_at:

>probe:Drosophila_2:1630703_at:447:465; Interrogation_Position=2028; Antisense; GATTGCAGTTGCTTGGTTCAGAACC
>probe:Drosophila_2:1630703_at:334:459; Interrogation_Position=2095; Antisense; GATATCTTCGTGTTTCATGCACCTA
>probe:Drosophila_2:1630703_at:535:473; Interrogation_Position=2136; Antisense; GTTAATGACTTTGTTCGAACGCTTT
>probe:Drosophila_2:1630703_at:175:379; Interrogation_Position=2152; Antisense; GAACGCTTTTTGTGTGATACGCCCG
>probe:Drosophila_2:1630703_at:292:673; Interrogation_Position=2169; Antisense; TACGCCCGTTTTGTATCTCTGATAA
>probe:Drosophila_2:1630703_at:464:39; Interrogation_Position=2183; Antisense; ATCTCTGATAACTAACTCTCTGCCA
>probe:Drosophila_2:1630703_at:495:193; Interrogation_Position=2196; Antisense; AACTCTCTGCCATGATAGCCAGTTC
>probe:Drosophila_2:1630703_at:611:673; Interrogation_Position=2211; Antisense; TAGCCAGTTCATTCATTCAGTTTGT
>probe:Drosophila_2:1630703_at:501:161; Interrogation_Position=2257; Antisense; AAATTTGAATAGTCGCGAAGCCAGG
>probe:Drosophila_2:1630703_at:113:203; Interrogation_Position=2273; Antisense; GAAGCCAGGATTTCGACCGTAAACG
>probe:Drosophila_2:1630703_at:288:135; Interrogation_Position=2337; Antisense; ACGCCGAAGTGAACCGCTGATACAG
>probe:Drosophila_2:1630703_at:1:173; Interrogation_Position=2382; Antisense; AAAGACTCGTACTCATATGCGCACC
>probe:Drosophila_2:1630703_at:77:349; Interrogation_Position=2416; Antisense; GCATGGCACATATGCAGACCCATAA
>probe:Drosophila_2:1630703_at:334:177; Interrogation_Position=2481; Antisense; AAACGACATTCTCTTGATCATACAA

Paste this into a BLAST search page for me
GATTGCAGTTGCTTGGTTCAGAACCGATATCTTCGTGTTTCATGCACCTAGTTAATGACTTTGTTCGAACGCTTTGAACGCTTTTTGTGTGATACGCCCGTACGCCCGTTTTGTATCTCTGATAAATCTCTGATAACTAACTCTCTGCCAAACTCTCTGCCATGATAGCCAGTTCTAGCCAGTTCATTCATTCAGTTTGTAAATTTGAATAGTCGCGAAGCCAGGGAAGCCAGGATTTCGACCGTAAACGACGCCGAAGTGAACCGCTGATACAGAAAGACTCGTACTCATATGCGCACCGCATGGCACATATGCAGACCCATAAAAACGACATTCTCTTGATCATACAA

Full Affymetrix probeset data:

Annotations for 1630703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720