Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630705_at:

>probe:Drosophila_2:1630705_at:499:685; Interrogation_Position=1083; Antisense; TATCAGTTCAATCAGCTGCCTCGAA
>probe:Drosophila_2:1630705_at:281:371; Interrogation_Position=1105; Antisense; GAAGGCTGCGCCACTCTAGCGAGCT
>probe:Drosophila_2:1630705_at:410:145; Interrogation_Position=1117; Antisense; ACTCTAGCGAGCTTAAGCGAACTCA
>probe:Drosophila_2:1630705_at:70:167; Interrogation_Position=1172; Antisense; AAATGAATGTGCACCCTTTGCGTAT
>probe:Drosophila_2:1630705_at:547:617; Interrogation_Position=1181; Antisense; TGCACCCTTTGCGTATATATGTTAA
>probe:Drosophila_2:1630705_at:654:343; Interrogation_Position=1211; Antisense; GCATAGTTTTACAAACTGCCCTCGC
>probe:Drosophila_2:1630705_at:355:633; Interrogation_Position=1232; Antisense; TCGCCCTCCAGAAAACGGTGTACGT
>probe:Drosophila_2:1630705_at:366:533; Interrogation_Position=1341; Antisense; GGTGTATTGCATTTCCTACAGTAGA
>probe:Drosophila_2:1630705_at:290:473; Interrogation_Position=1454; Antisense; GTTCAAAACAATTGCAAGCGCTTGG
>probe:Drosophila_2:1630705_at:330:359; Interrogation_Position=1467; Antisense; GCAAGCGCTTGGTAATTGGTTGTAA
>probe:Drosophila_2:1630705_at:384:491; Interrogation_Position=1488; Antisense; GTAAACTTAAATGGTTCCCACACAG
>probe:Drosophila_2:1630705_at:389:471; Interrogation_Position=1501; Antisense; GTTCCCACACAGGTTTTTTGCATTT
>probe:Drosophila_2:1630705_at:482:345; Interrogation_Position=1520; Antisense; GCATTTCAGATCGTACTCTTGGTAA
>probe:Drosophila_2:1630705_at:166:37; Interrogation_Position=1557; Antisense; ATCATACACGGGAAAGGCAGCTTTT

Paste this into a BLAST search page for me
TATCAGTTCAATCAGCTGCCTCGAAGAAGGCTGCGCCACTCTAGCGAGCTACTCTAGCGAGCTTAAGCGAACTCAAAATGAATGTGCACCCTTTGCGTATTGCACCCTTTGCGTATATATGTTAAGCATAGTTTTACAAACTGCCCTCGCTCGCCCTCCAGAAAACGGTGTACGTGGTGTATTGCATTTCCTACAGTAGAGTTCAAAACAATTGCAAGCGCTTGGGCAAGCGCTTGGTAATTGGTTGTAAGTAAACTTAAATGGTTCCCACACAGGTTCCCACACAGGTTTTTTGCATTTGCATTTCAGATCGTACTCTTGGTAAATCATACACGGGAAAGGCAGCTTTT

Full Affymetrix probeset data:

Annotations for 1630705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime