FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630707_at:

>probe:Drosophila_2:1630707_at:705:383; Interrogation_Position=1014; Antisense; GAACTGCCACAGAAATTCCCCATGA
>probe:Drosophila_2:1630707_at:6:11; Interrogation_Position=1028; Antisense; ATTCCCCATGAACGGCAAGGCATTG
>probe:Drosophila_2:1630707_at:126:73; Interrogation_Position=1045; Antisense; AGGCATTGTGCCTGATGAGTCTCGA
>probe:Drosophila_2:1630707_at:511:431; Interrogation_Position=1061; Antisense; GAGTCTCGATATGTACCTGTGCCGA
>probe:Drosophila_2:1630707_at:27:633; Interrogation_Position=1088; Antisense; TCCCGTGGGCGGCAAGATGCTCTAC
>probe:Drosophila_2:1630707_at:408:361; Interrogation_Position=1140; Antisense; GCAATGGCCCTGCTATCATAGGGAT
>probe:Drosophila_2:1630707_at:668:529; Interrogation_Position=1160; Antisense; GGGATTACCCATATATCTCACGGAT
>probe:Drosophila_2:1630707_at:430:27; Interrogation_Position=1183; Antisense; ATACCCAGTCCTCTCTATGGTTGTA
>probe:Drosophila_2:1630707_at:595:655; Interrogation_Position=1254; Antisense; TAATGCCTAGTCCTTAGTTCTGCTC
>probe:Drosophila_2:1630707_at:490:93; Interrogation_Position=1269; Antisense; AGTTCTGCTCGTCATTTAAGTATTA
>probe:Drosophila_2:1630707_at:260:373; Interrogation_Position=1390; Antisense; GAAGTTACAATGCTGTCCTATTAGT
>probe:Drosophila_2:1630707_at:106:445; Interrogation_Position=879; Antisense; GATGATGGCACCACCAGTCTGCTGC
>probe:Drosophila_2:1630707_at:589:653; Interrogation_Position=976; Antisense; TCAATATGGCCGTATCCGAGGGATT
>probe:Drosophila_2:1630707_at:716:81; Interrogation_Position=994; Antisense; AGGGATTGGAGGTCACCGCCGAACT

Paste this into a BLAST search page for me
GAACTGCCACAGAAATTCCCCATGAATTCCCCATGAACGGCAAGGCATTGAGGCATTGTGCCTGATGAGTCTCGAGAGTCTCGATATGTACCTGTGCCGATCCCGTGGGCGGCAAGATGCTCTACGCAATGGCCCTGCTATCATAGGGATGGGATTACCCATATATCTCACGGATATACCCAGTCCTCTCTATGGTTGTATAATGCCTAGTCCTTAGTTCTGCTCAGTTCTGCTCGTCATTTAAGTATTAGAAGTTACAATGCTGTCCTATTAGTGATGATGGCACCACCAGTCTGCTGCTCAATATGGCCGTATCCGAGGGATTAGGGATTGGAGGTCACCGCCGAACT

Full Affymetrix probeset data:

Annotations for 1630707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720