Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630710_at:

>probe:Drosophila_2:1630710_at:529:533; Interrogation_Position=2670; Antisense; GGTGACGAGCTGTCCATTATTGAGC
>probe:Drosophila_2:1630710_at:298:273; Interrogation_Position=2684; Antisense; CATTATTGAGCTGGGCGGCGTGTTT
>probe:Drosophila_2:1630710_at:245:531; Interrogation_Position=2721; Antisense; GGTGGCGTTCTCATCGGCGTTATCC
>probe:Drosophila_2:1630710_at:354:593; Interrogation_Position=2746; Antisense; TGGGCATCTTTGAGTTCCTGTGGAA
>probe:Drosophila_2:1630710_at:276:433; Interrogation_Position=2797; Antisense; GAGTGACTCCGTGGCAGGCTTTCAA
>probe:Drosophila_2:1630710_at:220:227; Interrogation_Position=2820; Antisense; AAGGCGGAGCTCATCTTTGCCCTGA
>probe:Drosophila_2:1630710_at:323:625; Interrogation_Position=2837; Antisense; TGCCCTGAAGTTTTGGGTGCGCAAA
>probe:Drosophila_2:1630710_at:220:359; Interrogation_Position=2857; Antisense; GCAAAAAGCCGATGCGCATCTCCAG
>probe:Drosophila_2:1630710_at:708:395; Interrogation_Position=2889; Antisense; GACAAGTCGTCGTCCAGGCGATCAT
>probe:Drosophila_2:1630710_at:634:219; Interrogation_Position=2940; Antisense; AAGTCCCGCAGCAAGACGGTTAGCT
>probe:Drosophila_2:1630710_at:142:79; Interrogation_Position=2955; Antisense; ACGGTTAGCTAGGTGGTCGGAATAT
>probe:Drosophila_2:1630710_at:388:137; Interrogation_Position=2983; Antisense; ACGATTGGCGTCTTCTACTTTGGCA
>probe:Drosophila_2:1630710_at:655:167; Interrogation_Position=3030; Antisense; AAATGAGGCACTCCATGGTGTCCAC
>probe:Drosophila_2:1630710_at:79:491; Interrogation_Position=3177; Antisense; GTAAACTTTTCTGTTGGCTCTAATG

Paste this into a BLAST search page for me
GGTGACGAGCTGTCCATTATTGAGCCATTATTGAGCTGGGCGGCGTGTTTGGTGGCGTTCTCATCGGCGTTATCCTGGGCATCTTTGAGTTCCTGTGGAAGAGTGACTCCGTGGCAGGCTTTCAAAAGGCGGAGCTCATCTTTGCCCTGATGCCCTGAAGTTTTGGGTGCGCAAAGCAAAAAGCCGATGCGCATCTCCAGGACAAGTCGTCGTCCAGGCGATCATAAGTCCCGCAGCAAGACGGTTAGCTACGGTTAGCTAGGTGGTCGGAATATACGATTGGCGTCTTCTACTTTGGCAAAATGAGGCACTCCATGGTGTCCACGTAAACTTTTCTGTTGGCTCTAATG

Full Affymetrix probeset data:

Annotations for 1630710_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime