Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630711_at:

>probe:Drosophila_2:1630711_at:145:691; Interrogation_Position=1958; Antisense; TTCTGGAAACCGGATCCCAATCGAT
>probe:Drosophila_2:1630711_at:479:633; Interrogation_Position=1972; Antisense; TCCCAATCGATCATCAGTCAGCGTT
>probe:Drosophila_2:1630711_at:394:261; Interrogation_Position=1990; Antisense; CAGCGTTTAGGTTAAGCTCACTAGT
>probe:Drosophila_2:1630711_at:318:147; Interrogation_Position=2009; Antisense; ACTAGTTGTAGGATATGCTCGATCT
>probe:Drosophila_2:1630711_at:302:91; Interrogation_Position=2040; Antisense; AGATTCCTCGGAATAACGACCAAAG
>probe:Drosophila_2:1630711_at:405:143; Interrogation_Position=2077; Antisense; ACTCAGTTTCAGTTCGTAGACTAAC
>probe:Drosophila_2:1630711_at:209:677; Interrogation_Position=2093; Antisense; TAGACTAACGTTACACTGCGAGAAT
>probe:Drosophila_2:1630711_at:249:295; Interrogation_Position=2111; Antisense; CGAGAATCGTATAGCGCGTTTATGC
>probe:Drosophila_2:1630711_at:36:329; Interrogation_Position=2126; Antisense; GCGTTTATGCGCCAGTCAATTTGTA
>probe:Drosophila_2:1630711_at:224:529; Interrogation_Position=2159; Antisense; GGGTCTGCATTCAGTTTTATTTGCT
>probe:Drosophila_2:1630711_at:299:691; Interrogation_Position=2178; Antisense; TTTGCTTTACTGAATAACACGACCT
>probe:Drosophila_2:1630711_at:553:165; Interrogation_Position=2384; Antisense; AAAATTGCCCAAGTCTAGTTCTAAG
>probe:Drosophila_2:1630711_at:115:401; Interrogation_Position=2483; Antisense; GACAGTCTAACCATCCACAGATCAA
>probe:Drosophila_2:1630711_at:443:69; Interrogation_Position=2531; Antisense; AGGCGTAACTGTTTTCTCACTTGAA

Paste this into a BLAST search page for me
TTCTGGAAACCGGATCCCAATCGATTCCCAATCGATCATCAGTCAGCGTTCAGCGTTTAGGTTAAGCTCACTAGTACTAGTTGTAGGATATGCTCGATCTAGATTCCTCGGAATAACGACCAAAGACTCAGTTTCAGTTCGTAGACTAACTAGACTAACGTTACACTGCGAGAATCGAGAATCGTATAGCGCGTTTATGCGCGTTTATGCGCCAGTCAATTTGTAGGGTCTGCATTCAGTTTTATTTGCTTTTGCTTTACTGAATAACACGACCTAAAATTGCCCAAGTCTAGTTCTAAGGACAGTCTAACCATCCACAGATCAAAGGCGTAACTGTTTTCTCACTTGAA

Full Affymetrix probeset data:

Annotations for 1630711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime