Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630713_at:

>probe:Drosophila_2:1630713_at:55:225; Interrogation_Position=231; Antisense; AAGGACTTTCTGCTTACTGGGCTCA
>probe:Drosophila_2:1630713_at:724:667; Interrogation_Position=245; Antisense; TACTGGGCTCAGTGAATCCGGCAAA
>probe:Drosophila_2:1630713_at:279:713; Interrogation_Position=279; Antisense; TTCATGCAGCTGATCCACGGCAAAT
>probe:Drosophila_2:1630713_at:530:123; Interrogation_Position=357; Antisense; AGCGCGTCTGCCAGGTTAGTGGATA
>probe:Drosophila_2:1630713_at:269:305; Interrogation_Position=385; Antisense; CCGGACATTATAGGGTGCGCGACAA
>probe:Drosophila_2:1630713_at:489:553; Interrogation_Position=416; Antisense; GGAGCTATATAAACACCGTGCCAAG
>probe:Drosophila_2:1630713_at:133:541; Interrogation_Position=464; Antisense; GGTTACTGCCCACAAGGATATCCGG
>probe:Drosophila_2:1630713_at:634:683; Interrogation_Position=482; Antisense; TATCCGGGATGTGGCAGACTTTCTG
>probe:Drosophila_2:1630713_at:648:105; Interrogation_Position=497; Antisense; AGACTTTCTGTACACCATCCTATCA
>probe:Drosophila_2:1630713_at:514:337; Interrogation_Position=541; Antisense; GCTCTGTGCTAGTCCTTTGCAACAA
>probe:Drosophila_2:1630713_at:205:433; Interrogation_Position=587; Antisense; GAGTGCCCAGGTCATTAAAAGCTTA
>probe:Drosophila_2:1630713_at:205:203; Interrogation_Position=705; Antisense; AAGCCAGGCCGTGACTTCGAATTCT
>probe:Drosophila_2:1630713_at:33:243; Interrogation_Position=744; Antisense; AATATCCAGTTTGCGGAAGCCTCCG
>probe:Drosophila_2:1630713_at:692:225; Interrogation_Position=771; Antisense; AAGGACACTGAACTTGATCCCCTCA

Paste this into a BLAST search page for me
AAGGACTTTCTGCTTACTGGGCTCATACTGGGCTCAGTGAATCCGGCAAATTCATGCAGCTGATCCACGGCAAATAGCGCGTCTGCCAGGTTAGTGGATACCGGACATTATAGGGTGCGCGACAAGGAGCTATATAAACACCGTGCCAAGGGTTACTGCCCACAAGGATATCCGGTATCCGGGATGTGGCAGACTTTCTGAGACTTTCTGTACACCATCCTATCAGCTCTGTGCTAGTCCTTTGCAACAAGAGTGCCCAGGTCATTAAAAGCTTAAAGCCAGGCCGTGACTTCGAATTCTAATATCCAGTTTGCGGAAGCCTCCGAAGGACACTGAACTTGATCCCCTCA

Full Affymetrix probeset data:

Annotations for 1630713_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime