Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630715_at:

>probe:Drosophila_2:1630715_at:702:63; Interrogation_Position=2639; Antisense; ATGTGGAGCAACGTATTGAAGCCTT
>probe:Drosophila_2:1630715_at:177:481; Interrogation_Position=2651; Antisense; GTATTGAAGCCTTTAGGTCTCGAAT
>probe:Drosophila_2:1630715_at:392:535; Interrogation_Position=2666; Antisense; GGTCTCGAATGGCTGAACTTGTCTC
>probe:Drosophila_2:1630715_at:336:385; Interrogation_Position=2680; Antisense; GAACTTGTCTCCCAGATGAGTGATA
>probe:Drosophila_2:1630715_at:591:173; Interrogation_Position=2745; Antisense; AAAGCTGGGCGACACAAGTTTGGAT
>probe:Drosophila_2:1630715_at:618:555; Interrogation_Position=2868; Antisense; GGACGTATTGAACTTCCTTAATGAT
>probe:Drosophila_2:1630715_at:16:387; Interrogation_Position=2912; Antisense; GAAAACTTTCTGTCCAAGTGGTGGG
>probe:Drosophila_2:1630715_at:564:245; Interrogation_Position=2956; Antisense; AATTCAACAGCCCAAGCCAGTCGAT
>probe:Drosophila_2:1630715_at:565:201; Interrogation_Position=2969; Antisense; AAGCCAGTCGATCCGGATCTTTGAG
>probe:Drosophila_2:1630715_at:143:449; Interrogation_Position=2978; Antisense; GATCCGGATCTTTGAGTGACTTATT
>probe:Drosophila_2:1630715_at:660:11; Interrogation_Position=3038; Antisense; ATTCAGCTAAGCCAATGACCGATAA
>probe:Drosophila_2:1630715_at:525:425; Interrogation_Position=3085; Antisense; GAGAGCGATGATCCTTCAAGCATTA
>probe:Drosophila_2:1630715_at:193:223; Interrogation_Position=3130; Antisense; AAGGATCTATATGTCTTTCCCCTGT
>probe:Drosophila_2:1630715_at:458:255; Interrogation_Position=3156; Antisense; CAACACCAATCCCAATCTTGCAAAT

Paste this into a BLAST search page for me
ATGTGGAGCAACGTATTGAAGCCTTGTATTGAAGCCTTTAGGTCTCGAATGGTCTCGAATGGCTGAACTTGTCTCGAACTTGTCTCCCAGATGAGTGATAAAAGCTGGGCGACACAAGTTTGGATGGACGTATTGAACTTCCTTAATGATGAAAACTTTCTGTCCAAGTGGTGGGAATTCAACAGCCCAAGCCAGTCGATAAGCCAGTCGATCCGGATCTTTGAGGATCCGGATCTTTGAGTGACTTATTATTCAGCTAAGCCAATGACCGATAAGAGAGCGATGATCCTTCAAGCATTAAAGGATCTATATGTCTTTCCCCTGTCAACACCAATCCCAATCTTGCAAAT

Full Affymetrix probeset data:

Annotations for 1630715_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime