FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630718_at:

>probe:Drosophila_2:1630718_at:124:511; Interrogation_Position=171; Antisense; GGGCCAGGAGTATACCGAAGCCTAT
>probe:Drosophila_2:1630718_at:293:133; Interrogation_Position=184; Antisense; ACCGAAGCCTATGTGATTGAGTACT
>probe:Drosophila_2:1630718_at:523:69; Interrogation_Position=211; Antisense; AGGCCGGGCCTCAAGAAATGGATTC
>probe:Drosophila_2:1630718_at:52:359; Interrogation_Position=254; Antisense; GCAAAGAGGTGCTGCCCGGCAACAT
>probe:Drosophila_2:1630718_at:134:567; Interrogation_Position=271; Antisense; GGCAACATAAACACCTACAGCGAGG
>probe:Drosophila_2:1630718_at:334:435; Interrogation_Position=292; Antisense; GAGGTGGAGAACGTGCTCCAGCCCA
>probe:Drosophila_2:1630718_at:412:121; Interrogation_Position=316; Antisense; AGCGTCTTTGCGTCCAAGGTGCGAC
>probe:Drosophila_2:1630718_at:184:685; Interrogation_Position=419; Antisense; TATCGTACAGTATTCCCAAGGGCAT
>probe:Drosophila_2:1630718_at:53:695; Interrogation_Position=507; Antisense; TTATGTCAACGGTTTGGGCCAACTT
>probe:Drosophila_2:1630718_at:400:361; Interrogation_Position=548; Antisense; GCAAGGACAACTTTCGAGCCGATAT
>probe:Drosophila_2:1630718_at:632:415; Interrogation_Position=563; Antisense; GAGCCGATATTAATGGCCTTGGCAA
>probe:Drosophila_2:1630718_at:291:3; Interrogation_Position=601; Antisense; ATTGGCTGGCGAAACGACACTTTGC
>probe:Drosophila_2:1630718_at:184:619; Interrogation_Position=623; Antisense; TGCTCGGGCGTCCAGTTGAAATCAT
>probe:Drosophila_2:1630718_at:513:219; Interrogation_Position=675; Antisense; AAGTGCTGTTATCATACACACCAAC

Paste this into a BLAST search page for me
GGGCCAGGAGTATACCGAAGCCTATACCGAAGCCTATGTGATTGAGTACTAGGCCGGGCCTCAAGAAATGGATTCGCAAAGAGGTGCTGCCCGGCAACATGGCAACATAAACACCTACAGCGAGGGAGGTGGAGAACGTGCTCCAGCCCAAGCGTCTTTGCGTCCAAGGTGCGACTATCGTACAGTATTCCCAAGGGCATTTATGTCAACGGTTTGGGCCAACTTGCAAGGACAACTTTCGAGCCGATATGAGCCGATATTAATGGCCTTGGCAAATTGGCTGGCGAAACGACACTTTGCTGCTCGGGCGTCCAGTTGAAATCATAAGTGCTGTTATCATACACACCAAC

Full Affymetrix probeset data:

Annotations for 1630718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720