Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630719_at:

>probe:Drosophila_2:1630719_at:527:285; Interrogation_Position=149; Antisense; CTGTTCTGAGAGTTGCGAGCTGCGA
>probe:Drosophila_2:1630719_at:166:609; Interrogation_Position=15; Antisense; TGAGACATCTCATTATCGCCAGCTT
>probe:Drosophila_2:1630719_at:673:119; Interrogation_Position=173; Antisense; AGCTGTGATCTGTGTGGCTCCCCGA
>probe:Drosophila_2:1630719_at:283:649; Interrogation_Position=198; Antisense; TCACGCCATGTGTAGTTTAGTTGCA
>probe:Drosophila_2:1630719_at:538:697; Interrogation_Position=213; Antisense; TTTAGTTGCAGTTTCGATTCACATC
>probe:Drosophila_2:1630719_at:98:463; Interrogation_Position=228; Antisense; GATTCACATCGGATTGCCTTGCCCA
>probe:Drosophila_2:1630719_at:217:33; Interrogation_Position=272; Antisense; ATCACGCACCAAAGGCCGGGAGACA
>probe:Drosophila_2:1630719_at:213:347; Interrogation_Position=347; Antisense; GCATGCGATTTATACGTGTCCAAGG
>probe:Drosophila_2:1630719_at:462:223; Interrogation_Position=368; Antisense; AAGGTTCACTCTGGATCGCAATGGA
>probe:Drosophila_2:1630719_at:295:589; Interrogation_Position=389; Antisense; TGGATGCAATTTGGCCACTTCACTG
>probe:Drosophila_2:1630719_at:711:147; Interrogation_Position=405; Antisense; ACTTCACTGCACATTTGACCGGATT
>probe:Drosophila_2:1630719_at:609:245; Interrogation_Position=42; Antisense; AATTCGAATCCTGCATCGCCGGGAG
>probe:Drosophila_2:1630719_at:322:249; Interrogation_Position=72; Antisense; CAATCCGTGGGCTTTGATGCAATTT
>probe:Drosophila_2:1630719_at:675:53; Interrogation_Position=88; Antisense; ATGCAATTTGGCTTCTGTGCAGGCC

Paste this into a BLAST search page for me
CTGTTCTGAGAGTTGCGAGCTGCGATGAGACATCTCATTATCGCCAGCTTAGCTGTGATCTGTGTGGCTCCCCGATCACGCCATGTGTAGTTTAGTTGCATTTAGTTGCAGTTTCGATTCACATCGATTCACATCGGATTGCCTTGCCCAATCACGCACCAAAGGCCGGGAGACAGCATGCGATTTATACGTGTCCAAGGAAGGTTCACTCTGGATCGCAATGGATGGATGCAATTTGGCCACTTCACTGACTTCACTGCACATTTGACCGGATTAATTCGAATCCTGCATCGCCGGGAGCAATCCGTGGGCTTTGATGCAATTTATGCAATTTGGCTTCTGTGCAGGCC

Full Affymetrix probeset data:

Annotations for 1630719_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime