FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630720_at:

>probe:Drosophila_2:1630720_at:261:623; Interrogation_Position=1191; Antisense; TGCGCGTCCTGCTCCAGAGGTAGTG
>probe:Drosophila_2:1630720_at:515:5; Interrogation_Position=1309; Antisense; ATTGTTCGTCCTGCTCCACAGGTGG
>probe:Drosophila_2:1630720_at:102:633; Interrogation_Position=1353; Antisense; TCCGCAAGTGATCTCGGTGGCTGCT
>probe:Drosophila_2:1630720_at:94:39; Interrogation_Position=1363; Antisense; ATCTCGGTGGCTGCTCCGCGCAATA
>probe:Drosophila_2:1630720_at:413:217; Interrogation_Position=1403; Antisense; AAGTCATCGCTCCTCGTAACACCTA
>probe:Drosophila_2:1630720_at:318:493; Interrogation_Position=1440; Antisense; GTAAGATGCCTCATCATCCGAAACA
>probe:Drosophila_2:1630720_at:542:185; Interrogation_Position=1461; Antisense; AACAACATTTCTGAGCAACCACCAA
>probe:Drosophila_2:1630720_at:717:259; Interrogation_Position=1480; Antisense; CACCAACTCAACTGGTTTGTGGTTT
>probe:Drosophila_2:1630720_at:99:697; Interrogation_Position=1502; Antisense; TTTAACCCACAACACCAACTATATT
>probe:Drosophila_2:1630720_at:207:255; Interrogation_Position=1511; Antisense; CAACACCAACTATATTCGAATGCTA
>probe:Drosophila_2:1630720_at:298:369; Interrogation_Position=1528; Antisense; GAATGCTAATTCACCATCTTGGCAA
>probe:Drosophila_2:1630720_at:525:515; Interrogation_Position=1586; Antisense; GTGTGTCTGACTTGATACGATTAGC
>probe:Drosophila_2:1630720_at:377:455; Interrogation_Position=1599; Antisense; GATACGATTAGCATATTCTCGAATT
>probe:Drosophila_2:1630720_at:638:345; Interrogation_Position=1609; Antisense; GCATATTCTCGAATTAGCGCAAAAG

Paste this into a BLAST search page for me
TGCGCGTCCTGCTCCAGAGGTAGTGATTGTTCGTCCTGCTCCACAGGTGGTCCGCAAGTGATCTCGGTGGCTGCTATCTCGGTGGCTGCTCCGCGCAATAAAGTCATCGCTCCTCGTAACACCTAGTAAGATGCCTCATCATCCGAAACAAACAACATTTCTGAGCAACCACCAACACCAACTCAACTGGTTTGTGGTTTTTTAACCCACAACACCAACTATATTCAACACCAACTATATTCGAATGCTAGAATGCTAATTCACCATCTTGGCAAGTGTGTCTGACTTGATACGATTAGCGATACGATTAGCATATTCTCGAATTGCATATTCTCGAATTAGCGCAAAAG

Full Affymetrix probeset data:

Annotations for 1630720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720