FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630724_at:

>probe:Drosophila_2:1630724_at:52:383; Interrogation_Position=108; Antisense; GAACGCAGTAGAACGCAGCCCAACA
>probe:Drosophila_2:1630724_at:1:303; Interrogation_Position=147; Antisense; CCGCATCCGGCAACTGGTGATTAAA
>probe:Drosophila_2:1630724_at:569:541; Interrogation_Position=198; Antisense; GGAGAAGTACTGCTACGCCAAGGAA
>probe:Drosophila_2:1630724_at:491:409; Interrogation_Position=271; Antisense; GACGACCACGTACTGCGCAAGCAGG
>probe:Drosophila_2:1630724_at:293:607; Interrogation_Position=320; Antisense; TGATGGTGCCCGACTCCAAGAGAAG
>probe:Drosophila_2:1630724_at:258:669; Interrogation_Position=365; Antisense; TACTGGAAAAGTACCTCGCCGATGA
>probe:Drosophila_2:1630724_at:607:613; Interrogation_Position=453; Antisense; TGAACTGGAGACCTAGAACCACCCC
>probe:Drosophila_2:1630724_at:23:181; Interrogation_Position=478; Antisense; AAAACTTAATTCACTGCCCCTAATG
>probe:Drosophila_2:1630724_at:710:615; Interrogation_Position=513; Antisense; TGCAAATTCCTGATGGCAATTCCAT
>probe:Drosophila_2:1630724_at:519:247; Interrogation_Position=530; Antisense; AATTCCATCTCCGAGCTCTGAGCTG
>probe:Drosophila_2:1630724_at:603:331; Interrogation_Position=559; Antisense; GCGGCTTGAATCCACACATACTGAG
>probe:Drosophila_2:1630724_at:347:27; Interrogation_Position=576; Antisense; ATACTGAGCTAATACTCTTCCCCTT
>probe:Drosophila_2:1630724_at:471:235; Interrogation_Position=642; Antisense; AATCGCCTAGTTGCTGGTGGCGTTC
>probe:Drosophila_2:1630724_at:660:291; Interrogation_Position=662; Antisense; CGTTCGCCTCACTTTTGCTAAATAA

Paste this into a BLAST search page for me
GAACGCAGTAGAACGCAGCCCAACACCGCATCCGGCAACTGGTGATTAAAGGAGAAGTACTGCTACGCCAAGGAAGACGACCACGTACTGCGCAAGCAGGTGATGGTGCCCGACTCCAAGAGAAGTACTGGAAAAGTACCTCGCCGATGATGAACTGGAGACCTAGAACCACCCCAAAACTTAATTCACTGCCCCTAATGTGCAAATTCCTGATGGCAATTCCATAATTCCATCTCCGAGCTCTGAGCTGGCGGCTTGAATCCACACATACTGAGATACTGAGCTAATACTCTTCCCCTTAATCGCCTAGTTGCTGGTGGCGTTCCGTTCGCCTCACTTTTGCTAAATAA

Full Affymetrix probeset data:

Annotations for 1630724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720