FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630725_at:

>probe:Drosophila_2:1630725_at:90:257; Interrogation_Position=320; Antisense; CACAACCGAGCTGCCTCTGGAGGAT
>probe:Drosophila_2:1630725_at:553:549; Interrogation_Position=338; Antisense; GGAGGATTTGTCGACCAGCACTACA
>probe:Drosophila_2:1630725_at:99:113; Interrogation_Position=354; Antisense; AGCACTACAGATCCAACCGACGACT
>probe:Drosophila_2:1630725_at:139:281; Interrogation_Position=435; Antisense; CTCGCTGTGGAATCCCGTACGGGTC
>probe:Drosophila_2:1630725_at:34:571; Interrogation_Position=461; Antisense; GGCTTTTGTAAAAGCTCCTTATCCA
>probe:Drosophila_2:1630725_at:534:75; Interrogation_Position=544; Antisense; AGGAGCAGAAAACCTCCTCCAGCAA
>probe:Drosophila_2:1630725_at:553:155; Interrogation_Position=577; Antisense; ACAGCAATGCCGATCACCCGGTCTG
>probe:Drosophila_2:1630725_at:321:143; Interrogation_Position=629; Antisense; CACTCCGGAACCTGGATCCAAGGAT
>probe:Drosophila_2:1630725_at:386:289; Interrogation_Position=664; Antisense; CGGAGAGTGTGGTCTTTACTGCAAA
>probe:Drosophila_2:1630725_at:366:707; Interrogation_Position=679; Antisense; TTACTGCAAATGTGGGACCTGCTGT
>probe:Drosophila_2:1630725_at:515:601; Interrogation_Position=701; Antisense; TGTAGTGGTGGCTAGAGTTCCCTCC
>probe:Drosophila_2:1630725_at:374:7; Interrogation_Position=729; Antisense; ATTCCGGTGGCTATTCCCCTGCGAT
>probe:Drosophila_2:1630725_at:323:459; Interrogation_Position=787; Antisense; GATTTGTCTACACCACGCATGTGGA
>probe:Drosophila_2:1630725_at:181:525; Interrogation_Position=826; Antisense; GGGACGGAAGGTACTCATTATCATT

Paste this into a BLAST search page for me
CACAACCGAGCTGCCTCTGGAGGATGGAGGATTTGTCGACCAGCACTACAAGCACTACAGATCCAACCGACGACTCTCGCTGTGGAATCCCGTACGGGTCGGCTTTTGTAAAAGCTCCTTATCCAAGGAGCAGAAAACCTCCTCCAGCAAACAGCAATGCCGATCACCCGGTCTGCACTCCGGAACCTGGATCCAAGGATCGGAGAGTGTGGTCTTTACTGCAAATTACTGCAAATGTGGGACCTGCTGTTGTAGTGGTGGCTAGAGTTCCCTCCATTCCGGTGGCTATTCCCCTGCGATGATTTGTCTACACCACGCATGTGGAGGGACGGAAGGTACTCATTATCATT

Full Affymetrix probeset data:

Annotations for 1630725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720