FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630726_at:

>probe:Drosophila_2:1630726_at:198:59; Interrogation_Position=13; Antisense; ATGATGCAGCAACGAATTTCCGGAT
>probe:Drosophila_2:1630726_at:185:445; Interrogation_Position=15; Antisense; GATGCAGCAACGAATTTCCGGATTT
>probe:Drosophila_2:1630726_at:89:23; Interrogation_Position=153; Antisense; ATATATTCAGTTTGCCACCAGAGCT
>probe:Drosophila_2:1630726_at:635:349; Interrogation_Position=18; Antisense; GCAGCAACGAATTTCCGGATTTTGG
>probe:Drosophila_2:1630726_at:67:159; Interrogation_Position=226; Antisense; ACAAAATTCATAGTAAAGCGACGGA
>probe:Drosophila_2:1630726_at:688:363; Interrogation_Position=26; Antisense; GAATTTCCGGATTTTGGCAGGGCCA
>probe:Drosophila_2:1630726_at:276:695; Interrogation_Position=29; Antisense; TTTCCGGATTTTGGCAGGGCCAACT
>probe:Drosophila_2:1630726_at:625:701; Interrogation_Position=37; Antisense; TTTTGGCAGGGCCAACTGCCTGTAT
>probe:Drosophila_2:1630726_at:406:83; Interrogation_Position=44; Antisense; AGGGCCAACTGCCTGTATACCGCTT
>probe:Drosophila_2:1630726_at:28:311; Interrogation_Position=48; Antisense; CCAACTGCCTGTATACCGCTTAAAA
>probe:Drosophila_2:1630726_at:620:313; Interrogation_Position=54; Antisense; GCCTGTATACCGCTTAAAATTCCTG
>probe:Drosophila_2:1630726_at:390:481; Interrogation_Position=58; Antisense; GTATACCGCTTAAAATTCCTGATCA
>probe:Drosophila_2:1630726_at:7:29; Interrogation_Position=60; Antisense; ATACCGCTTAAAATTCCTGATCACA
>probe:Drosophila_2:1630726_at:616:303; Interrogation_Position=63; Antisense; CCGCTTAAAATTCCTGATCACATTG

Paste this into a BLAST search page for me
ATGATGCAGCAACGAATTTCCGGATGATGCAGCAACGAATTTCCGGATTTATATATTCAGTTTGCCACCAGAGCTGCAGCAACGAATTTCCGGATTTTGGACAAAATTCATAGTAAAGCGACGGAGAATTTCCGGATTTTGGCAGGGCCATTTCCGGATTTTGGCAGGGCCAACTTTTTGGCAGGGCCAACTGCCTGTATAGGGCCAACTGCCTGTATACCGCTTCCAACTGCCTGTATACCGCTTAAAAGCCTGTATACCGCTTAAAATTCCTGGTATACCGCTTAAAATTCCTGATCAATACCGCTTAAAATTCCTGATCACACCGCTTAAAATTCCTGATCACATTG

Full Affymetrix probeset data:

Annotations for 1630726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720