FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630727_at:

>probe:Drosophila_2:1630727_at:447:677; Interrogation_Position=125; Antisense; TAGTTGCGATGGTTTCCCTAGCGAA
>probe:Drosophila_2:1630727_at:265:673; Interrogation_Position=143; Antisense; TAGCGAAGCCGGGAGAAGCCACCTT
>probe:Drosophila_2:1630727_at:424:249; Interrogation_Position=171; Antisense; CAAGCTTAATCTTCTTCTGGGCGGA
>probe:Drosophila_2:1630727_at:482:257; Interrogation_Position=198; Antisense; CACTACGTCTGGCTATGGATCTGGA
>probe:Drosophila_2:1630727_at:370:289; Interrogation_Position=231; Antisense; CGGCTATGGTTCTGGCTACGGCTAT
>probe:Drosophila_2:1630727_at:589:583; Interrogation_Position=243; Antisense; TGGCTACGGCTATGGATCTGGCTAT
>probe:Drosophila_2:1630727_at:549:25; Interrogation_Position=276; Antisense; ATATGGCGCCGGCTATGGATACGCT
>probe:Drosophila_2:1630727_at:240:457; Interrogation_Position=293; Antisense; GATACGCTCCCGAGAACGTGGTGAA
>probe:Drosophila_2:1630727_at:327:681; Interrogation_Position=412; Antisense; TATGGCGGTGGCTATTCCAGCGGCT
>probe:Drosophila_2:1630727_at:632:315; Interrogation_Position=469; Antisense; GCCGTGGTTACACCGGTGGTCACAT
>probe:Drosophila_2:1630727_at:401:3; Interrogation_Position=576; Antisense; ATTGGGTGGCTATGGAAGCTCCTTC
>probe:Drosophila_2:1630727_at:370:629; Interrogation_Position=625; Antisense; TCCTACGGCTATGGCGCTGGCTATG
>probe:Drosophila_2:1630727_at:210:689; Interrogation_Position=664; Antisense; TTTGGACTGGGATTCGGTGCACCAC
>probe:Drosophila_2:1630727_at:291:149; Interrogation_Position=696; Antisense; ACTTGGCTTGGCTGGAGGACTCTGC

Paste this into a BLAST search page for me
TAGTTGCGATGGTTTCCCTAGCGAATAGCGAAGCCGGGAGAAGCCACCTTCAAGCTTAATCTTCTTCTGGGCGGACACTACGTCTGGCTATGGATCTGGACGGCTATGGTTCTGGCTACGGCTATTGGCTACGGCTATGGATCTGGCTATATATGGCGCCGGCTATGGATACGCTGATACGCTCCCGAGAACGTGGTGAATATGGCGGTGGCTATTCCAGCGGCTGCCGTGGTTACACCGGTGGTCACATATTGGGTGGCTATGGAAGCTCCTTCTCCTACGGCTATGGCGCTGGCTATGTTTGGACTGGGATTCGGTGCACCACACTTGGCTTGGCTGGAGGACTCTGC

Full Affymetrix probeset data:

Annotations for 1630727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720