FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630730_at:

>probe:Drosophila_2:1630730_at:458:277; Interrogation_Position=2571; Antisense; CTGAAAACACACATGCGGACGCACA
>probe:Drosophila_2:1630730_at:79:705; Interrogation_Position=2609; Antisense; TTACCAATGTTGCTACTGTTCGCGC
>probe:Drosophila_2:1630730_at:452:477; Interrogation_Position=2635; Antisense; GTTTTGCCGACAACAGCACTCATCG
>probe:Drosophila_2:1630730_at:253:209; Interrogation_Position=2661; Antisense; AAGCACGAACGTTTGCACACGAATG
>probe:Drosophila_2:1630730_at:558:55; Interrogation_Position=2683; Antisense; ATGAAAGACCCTATGCTTGCAACAT
>probe:Drosophila_2:1630730_at:243:585; Interrogation_Position=2711; Antisense; TGGAAAAACATTCTCTCTGTCCTCC
>probe:Drosophila_2:1630730_at:374:147; Interrogation_Position=2749; Antisense; ACTACTACCTGCATTCGTCTGAAAA
>probe:Drosophila_2:1630730_at:278:361; Interrogation_Position=2802; Antisense; GAATTTCGGCTTAAGCACCAACTTA
>probe:Drosophila_2:1630730_at:548:353; Interrogation_Position=2816; Antisense; GCACCAACTTACAGCGCACGAGAAG
>probe:Drosophila_2:1630730_at:112:723; Interrogation_Position=2845; Antisense; TTGCGCACCGTCTGATAGCTAAGGA
>probe:Drosophila_2:1630730_at:260:689; Interrogation_Position=2976; Antisense; TATTAGCTCTCTAACATTTCCGGAG
>probe:Drosophila_2:1630730_at:518:65; Interrogation_Position=3009; Antisense; ATGGTTTGCTCCATTTTGTTGCGGT
>probe:Drosophila_2:1630730_at:75:123; Interrogation_Position=3039; Antisense; AGCGTTTGCAGGTGAGCTTTCAGCT
>probe:Drosophila_2:1630730_at:319:369; Interrogation_Position=3077; Antisense; GAATGACTTGCAACAGATACCACAG

Paste this into a BLAST search page for me
CTGAAAACACACATGCGGACGCACATTACCAATGTTGCTACTGTTCGCGCGTTTTGCCGACAACAGCACTCATCGAAGCACGAACGTTTGCACACGAATGATGAAAGACCCTATGCTTGCAACATTGGAAAAACATTCTCTCTGTCCTCCACTACTACCTGCATTCGTCTGAAAAGAATTTCGGCTTAAGCACCAACTTAGCACCAACTTACAGCGCACGAGAAGTTGCGCACCGTCTGATAGCTAAGGATATTAGCTCTCTAACATTTCCGGAGATGGTTTGCTCCATTTTGTTGCGGTAGCGTTTGCAGGTGAGCTTTCAGCTGAATGACTTGCAACAGATACCACAG

Full Affymetrix probeset data:

Annotations for 1630730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720