FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630732_at:

>probe:Drosophila_2:1630732_at:464:199; Interrogation_Position=2696; Antisense; AACGAGCGGATGCAGCCCTTCCTGG
>probe:Drosophila_2:1630732_at:392:71; Interrogation_Position=2724; Antisense; AGGCGCTGGAGGCACTGCCCAAAAA
>probe:Drosophila_2:1630732_at:75:189; Interrogation_Position=2750; Antisense; AACAGCGGTGGCTACGTGACAGCCA
>probe:Drosophila_2:1630732_at:219:113; Interrogation_Position=2801; Antisense; AGCACAGTTCTGAGAGCGGACACAA
>probe:Drosophila_2:1630732_at:47:291; Interrogation_Position=2826; Antisense; CGAAAGCCATTTCGCAAGCCTTGAA
>probe:Drosophila_2:1630732_at:594:203; Interrogation_Position=2841; Antisense; AAGCCTTGAAAACCTTCACGCGACT
>probe:Drosophila_2:1630732_at:477:325; Interrogation_Position=2860; Antisense; GCGACTCTTTCGCTAATCAGGGAGA
>probe:Drosophila_2:1630732_at:715:353; Interrogation_Position=2969; Antisense; GCACGTACCCCTCTATTTATAATAT
>probe:Drosophila_2:1630732_at:388:363; Interrogation_Position=3035; Antisense; GAATTGTACATTTTGAGTGCGGTCA
>probe:Drosophila_2:1630732_at:284:433; Interrogation_Position=3049; Antisense; GAGTGCGGTCAAGAGATCCTCACAG
>probe:Drosophila_2:1630732_at:498:427; Interrogation_Position=3061; Antisense; GAGATCCTCACAGAATTTAGCAGTA
>probe:Drosophila_2:1630732_at:684:475; Interrogation_Position=3087; Antisense; GTTATTTACATCAGCGTGCACTCCT
>probe:Drosophila_2:1630732_at:391:509; Interrogation_Position=3102; Antisense; GTGCACTCCTAGCTCTAAGTTTAAA
>probe:Drosophila_2:1630732_at:630:29; Interrogation_Position=3191; Antisense; ATAATTGACCACATTTGTTCTGCAA

Paste this into a BLAST search page for me
AACGAGCGGATGCAGCCCTTCCTGGAGGCGCTGGAGGCACTGCCCAAAAAAACAGCGGTGGCTACGTGACAGCCAAGCACAGTTCTGAGAGCGGACACAACGAAAGCCATTTCGCAAGCCTTGAAAAGCCTTGAAAACCTTCACGCGACTGCGACTCTTTCGCTAATCAGGGAGAGCACGTACCCCTCTATTTATAATATGAATTGTACATTTTGAGTGCGGTCAGAGTGCGGTCAAGAGATCCTCACAGGAGATCCTCACAGAATTTAGCAGTAGTTATTTACATCAGCGTGCACTCCTGTGCACTCCTAGCTCTAAGTTTAAAATAATTGACCACATTTGTTCTGCAA

Full Affymetrix probeset data:

Annotations for 1630732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720