Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630735_at:

>probe:Drosophila_2:1630735_at:558:503; Interrogation_Position=170; Antisense; GTCCACTGAGCATATCGCCGGTAAT
>probe:Drosophila_2:1630735_at:96:41; Interrogation_Position=222; Antisense; ATCGGTGGATTTATCGGCCATAGCT
>probe:Drosophila_2:1630735_at:276:225; Interrogation_Position=259; Antisense; AAGGAGTGCCTGAGCATCTGCGAGC
>probe:Drosophila_2:1630735_at:356:115; Interrogation_Position=311; Antisense; AGCAGGGACGACTCTTCGCGGTTGT
>probe:Drosophila_2:1630735_at:319:467; Interrogation_Position=331; Antisense; GTTGTCCACCTGTGCGGCAAGCAAT
>probe:Drosophila_2:1630735_at:129:589; Interrogation_Position=386; Antisense; TGGAGGGATACTGGCCGCCAACGAT
>probe:Drosophila_2:1630735_at:305:95; Interrogation_Position=419; Antisense; AGATCAGCCTGGATAAGGTGCTCCT
>probe:Drosophila_2:1630735_at:144:227; Interrogation_Position=473; Antisense; GAAGGCCCATTTTGGAGCCCGGACT
>probe:Drosophila_2:1630735_at:191:415; Interrogation_Position=487; Antisense; GAGCCCGGACTCATCTTGGTGAAGG
>probe:Drosophila_2:1630735_at:235:423; Interrogation_Position=523; Antisense; GAGAAGACGCTCAGCCACACGAAGA
>probe:Drosophila_2:1630735_at:234:491; Interrogation_Position=576; Antisense; GTACATGCGCATCAACTTCCAGAGA
>probe:Drosophila_2:1630735_at:228:261; Interrogation_Position=609; Antisense; CACCATGGTCCGGATCAATTCAATT
>probe:Drosophila_2:1630735_at:621:245; Interrogation_Position=625; Antisense; AATTCAATTGAACTGGCTCGTCCAG
>probe:Drosophila_2:1630735_at:35:631; Interrogation_Position=676; Antisense; TCCTCGAGGCGCTTGTTTTAGTTTA

Paste this into a BLAST search page for me
GTCCACTGAGCATATCGCCGGTAATATCGGTGGATTTATCGGCCATAGCTAAGGAGTGCCTGAGCATCTGCGAGCAGCAGGGACGACTCTTCGCGGTTGTGTTGTCCACCTGTGCGGCAAGCAATTGGAGGGATACTGGCCGCCAACGATAGATCAGCCTGGATAAGGTGCTCCTGAAGGCCCATTTTGGAGCCCGGACTGAGCCCGGACTCATCTTGGTGAAGGGAGAAGACGCTCAGCCACACGAAGAGTACATGCGCATCAACTTCCAGAGACACCATGGTCCGGATCAATTCAATTAATTCAATTGAACTGGCTCGTCCAGTCCTCGAGGCGCTTGTTTTAGTTTA

Full Affymetrix probeset data:

Annotations for 1630735_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime