Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630736_at:

>probe:Drosophila_2:1630736_at:563:617; Interrogation_Position=113; Antisense; TGCTTGCGGACCAGGACGATGGAAC
>probe:Drosophila_2:1630736_at:425:49; Interrogation_Position=145; Antisense; ATGCGGGACAAGAAGCTAACGCTCG
>probe:Drosophila_2:1630736_at:700:337; Interrogation_Position=159; Antisense; GCTAACGCTCGAATTGAAGTTGCAA
>probe:Drosophila_2:1630736_at:198:327; Interrogation_Position=17; Antisense; GCGATGTCAGCGCAAATCACAGCAG
>probe:Drosophila_2:1630736_at:688:595; Interrogation_Position=187; Antisense; TGTGATGAATATGTTGAGCAGCCAA
>probe:Drosophila_2:1630736_at:474:383; Interrogation_Position=226; Antisense; GAACGGCTGCAACCAGCTCAGATTG
>probe:Drosophila_2:1630736_at:121:339; Interrogation_Position=241; Antisense; GCTCAGATTGCCAACGACAATGCTC
>probe:Drosophila_2:1630736_at:727:291; Interrogation_Position=266; Antisense; CGTCGCCTCTGCATTTGAAACTGGA
>probe:Drosophila_2:1630736_at:424:239; Interrogation_Position=31; Antisense; AATCACAGCAGCTCCTTTCTTTCGT
>probe:Drosophila_2:1630736_at:714:503; Interrogation_Position=331; Antisense; GTCCTGGAACTGACCGGAGCAGCAG
>probe:Drosophila_2:1630736_at:273:421; Interrogation_Position=347; Antisense; GAGCAGCAGTTGCTCTCTATGGCCA
>probe:Drosophila_2:1630736_at:474:337; Interrogation_Position=358; Antisense; GCTCTCTATGGCCACTTGAACAATG
>probe:Drosophila_2:1630736_at:473:387; Interrogation_Position=375; Antisense; GAACAATGCCAGCAAGGATGTGCGA
>probe:Drosophila_2:1630736_at:648:349; Interrogation_Position=408; Antisense; GCAGTGTCTGAAATTGCAGGACCCA

Paste this into a BLAST search page for me
TGCTTGCGGACCAGGACGATGGAACATGCGGGACAAGAAGCTAACGCTCGGCTAACGCTCGAATTGAAGTTGCAAGCGATGTCAGCGCAAATCACAGCAGTGTGATGAATATGTTGAGCAGCCAAGAACGGCTGCAACCAGCTCAGATTGGCTCAGATTGCCAACGACAATGCTCCGTCGCCTCTGCATTTGAAACTGGAAATCACAGCAGCTCCTTTCTTTCGTGTCCTGGAACTGACCGGAGCAGCAGGAGCAGCAGTTGCTCTCTATGGCCAGCTCTCTATGGCCACTTGAACAATGGAACAATGCCAGCAAGGATGTGCGAGCAGTGTCTGAAATTGCAGGACCCA

Full Affymetrix probeset data:

Annotations for 1630736_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime