Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630737_at:

>probe:Drosophila_2:1630737_at:676:575; Interrogation_Position=1522; Antisense; GGCGAGGATGCCAACGATGATCAAT
>probe:Drosophila_2:1630737_at:135:443; Interrogation_Position=1537; Antisense; GATGATCAATGCGTTGCTAACTTAA
>probe:Drosophila_2:1630737_at:160:231; Interrogation_Position=1566; Antisense; AATGAAGCGTTCCTCATTTCTTCTT
>probe:Drosophila_2:1630737_at:404:279; Interrogation_Position=1578; Antisense; CTCATTTCTTCTTTGCTCATGGGAA
>probe:Drosophila_2:1630737_at:310:603; Interrogation_Position=1610; Antisense; TGTTGGGCAGCGAACTGTACCAGCT
>probe:Drosophila_2:1630737_at:135:521; Interrogation_Position=1636; Antisense; GTGGAAATTATCCTGGCGTCTCATT
>probe:Drosophila_2:1630737_at:455:581; Interrogation_Position=1649; Antisense; TGGCGTCTCATTATTTGGGCATCGA
>probe:Drosophila_2:1630737_at:250:593; Interrogation_Position=1664; Antisense; TGGGCATCGAGTCGCTGACACTGAA
>probe:Drosophila_2:1630737_at:293:613; Interrogation_Position=1685; Antisense; TGAACGCCATTCATCATTTCTGTGA
>probe:Drosophila_2:1630737_at:698:227; Interrogation_Position=1713; Antisense; AATGGCTCAAAGGACTCGCTCGGAA
>probe:Drosophila_2:1630737_at:440:635; Interrogation_Position=1728; Antisense; TCGCTCGGAATGCTGCCTAATGCTA
>probe:Drosophila_2:1630737_at:232:543; Interrogation_Position=1791; Antisense; GGATAACCACTGTCCGTTGATCAGG
>probe:Drosophila_2:1630737_at:102:453; Interrogation_Position=1809; Antisense; GATCAGGGACTCACTGTCGCGAAAT
>probe:Drosophila_2:1630737_at:18:365; Interrogation_Position=1880; Antisense; GAATCTTCAGGAAACCACAACCGAA

Paste this into a BLAST search page for me
GGCGAGGATGCCAACGATGATCAATGATGATCAATGCGTTGCTAACTTAAAATGAAGCGTTCCTCATTTCTTCTTCTCATTTCTTCTTTGCTCATGGGAATGTTGGGCAGCGAACTGTACCAGCTGTGGAAATTATCCTGGCGTCTCATTTGGCGTCTCATTATTTGGGCATCGATGGGCATCGAGTCGCTGACACTGAATGAACGCCATTCATCATTTCTGTGAAATGGCTCAAAGGACTCGCTCGGAATCGCTCGGAATGCTGCCTAATGCTAGGATAACCACTGTCCGTTGATCAGGGATCAGGGACTCACTGTCGCGAAATGAATCTTCAGGAAACCACAACCGAA

Full Affymetrix probeset data:

Annotations for 1630737_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime