FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630740_at:

>probe:Drosophila_2:1630740_at:393:401; Interrogation_Position=153; Antisense; GACATGTGTGGATTCCCTGGACTAT
>probe:Drosophila_2:1630740_at:524:557; Interrogation_Position=171; Antisense; GGACTATTGTGTGACCATCTACGAT
>probe:Drosophila_2:1630740_at:489:469; Interrogation_Position=218; Antisense; GTTGCTCCCTCGAGATTCCGAAGGA
>probe:Drosophila_2:1630740_at:451:463; Interrogation_Position=231; Antisense; GATTCCGAAGGACTTGCGTTCCAAA
>probe:Drosophila_2:1630740_at:624:231; Interrogation_Position=259; Antisense; AATGACAATCGCTCTTGCCACAAGT
>probe:Drosophila_2:1630740_at:358:39; Interrogation_Position=312; Antisense; ATCTGCGAAGTACGCGTGCATTCAG
>probe:Drosophila_2:1630740_at:656:291; Interrogation_Position=326; Antisense; CGTGCATTCAGTGCGATTCCAGCAA
>probe:Drosophila_2:1630740_at:223:79; Interrogation_Position=350; Antisense; AGGATTCCAATTGCGCTTCTAATGC
>probe:Drosophila_2:1630740_at:660:141; Interrogation_Position=409; Antisense; ACGGCTCCAAACTCGTATTGCTATG
>probe:Drosophila_2:1630740_at:113:691; Interrogation_Position=424; Antisense; TATTGCTATGTGAAATCCTCGGGAG
>probe:Drosophila_2:1630740_at:411:261; Interrogation_Position=474; Antisense; CACCGAAACCGATCAGCAGAGCTGT
>probe:Drosophila_2:1630740_at:602:417; Interrogation_Position=492; Antisense; GAGCTGTCTGAACGATGCCAACTGC
>probe:Drosophila_2:1630740_at:160:617; Interrogation_Position=547; Antisense; TGCAATGCTGCCAACATCGTCGAGA
>probe:Drosophila_2:1630740_at:637:679; Interrogation_Position=63; Antisense; TATGGTGGGTCATGTGGCCGCTAAC

Paste this into a BLAST search page for me
GACATGTGTGGATTCCCTGGACTATGGACTATTGTGTGACCATCTACGATGTTGCTCCCTCGAGATTCCGAAGGAGATTCCGAAGGACTTGCGTTCCAAAAATGACAATCGCTCTTGCCACAAGTATCTGCGAAGTACGCGTGCATTCAGCGTGCATTCAGTGCGATTCCAGCAAAGGATTCCAATTGCGCTTCTAATGCACGGCTCCAAACTCGTATTGCTATGTATTGCTATGTGAAATCCTCGGGAGCACCGAAACCGATCAGCAGAGCTGTGAGCTGTCTGAACGATGCCAACTGCTGCAATGCTGCCAACATCGTCGAGATATGGTGGGTCATGTGGCCGCTAAC

Full Affymetrix probeset data:

Annotations for 1630740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720