Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630741_s_at:

>probe:Drosophila_2:1630741_s_at:373:119; Interrogation_Position=1091; Antisense; AGCTGCGCCCAAGGTCTAGGCTGGA
>probe:Drosophila_2:1630741_s_at:197:277; Interrogation_Position=1106; Antisense; CTAGGCTGGATTGGAGGGCCCTCAT
>probe:Drosophila_2:1630741_s_at:62:43; Interrogation_Position=1129; Antisense; ATCGTCCTCGCAAAGCTTACGAGTT
>probe:Drosophila_2:1630741_s_at:560:97; Interrogation_Position=1217; Antisense; AGATGTCTCTTCTAACATTTCACAA
>probe:Drosophila_2:1630741_s_at:508:701; Interrogation_Position=692; Antisense; TTATAGCTTTGGCATCGGCGGCGAT
>probe:Drosophila_2:1630741_s_at:555:439; Interrogation_Position=714; Antisense; GATGGCATGATTTACACCGGCAGGG
>probe:Drosophila_2:1630741_s_at:23:531; Interrogation_Position=737; Antisense; GGGATTCAATGTCATCGGAGCTCAT
>probe:Drosophila_2:1630741_s_at:174:553; Interrogation_Position=753; Antisense; GGAGCTCATGCACCCAAGTACAATG
>probe:Drosophila_2:1630741_s_at:351:427; Interrogation_Position=805; Antisense; GAGATTGGAGAACCGAACTGCCGCC
>probe:Drosophila_2:1630741_s_at:129:209; Interrogation_Position=831; Antisense; AAGCAGATGCTGGATGCGGCCAAGA
>probe:Drosophila_2:1630741_s_at:139:253; Interrogation_Position=851; Antisense; CAAGAACCTGATCGCCTTTGGCGTT
>probe:Drosophila_2:1630741_s_at:175:275; Interrogation_Position=866; Antisense; CTTTGGCGTTTTCAAGGGCTACATT
>probe:Drosophila_2:1630741_s_at:247:151; Interrogation_Position=920; Antisense; ACAGGTGCGGGATACCGAGTGTCCT
>probe:Drosophila_2:1630741_s_at:7:177; Interrogation_Position=995; Antisense; AAACGACACCGAAGGCGTCAGCAGC

Paste this into a BLAST search page for me
AGCTGCGCCCAAGGTCTAGGCTGGACTAGGCTGGATTGGAGGGCCCTCATATCGTCCTCGCAAAGCTTACGAGTTAGATGTCTCTTCTAACATTTCACAATTATAGCTTTGGCATCGGCGGCGATGATGGCATGATTTACACCGGCAGGGGGGATTCAATGTCATCGGAGCTCATGGAGCTCATGCACCCAAGTACAATGGAGATTGGAGAACCGAACTGCCGCCAAGCAGATGCTGGATGCGGCCAAGACAAGAACCTGATCGCCTTTGGCGTTCTTTGGCGTTTTCAAGGGCTACATTACAGGTGCGGGATACCGAGTGTCCTAAACGACACCGAAGGCGTCAGCAGC

Full Affymetrix probeset data:

Annotations for 1630741_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime