FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630742_at:

>probe:Drosophila_2:1630742_at:180:343; Interrogation_Position=1351; Antisense; GCTTCGATCGTTTCGGATCCACGAT
>probe:Drosophila_2:1630742_at:154:449; Interrogation_Position=1366; Antisense; GATCCACGATTTCAGGCCGGCGAGA
>probe:Drosophila_2:1630742_at:296:577; Interrogation_Position=1380; Antisense; GGCCGGCGAGAATCTACCCGAATAT
>probe:Drosophila_2:1630742_at:75:297; Interrogation_Position=1398; Antisense; CGAATATATCTTCCACGGGCCATAT
>probe:Drosophila_2:1630742_at:268:27; Interrogation_Position=1421; Antisense; ATAGCAATGCCAGCGAGATTTCGAT
>probe:Drosophila_2:1630742_at:307:617; Interrogation_Position=1448; Antisense; TGCACTTCTACTACATGACCAACAT
>probe:Drosophila_2:1630742_at:215:57; Interrogation_Position=1462; Antisense; ATGACCAACATATTTCGCAGCACCA
>probe:Drosophila_2:1630742_at:652:83; Interrogation_Position=1490; Antisense; AGTCCGAGATGTTTGGCTTTACCGA
>probe:Drosophila_2:1630742_at:215:243; Interrogation_Position=1577; Antisense; AATTTCCAGCTAATACGGGCGGCCT
>probe:Drosophila_2:1630742_at:233:689; Interrogation_Position=1602; Antisense; TTTGGGACTTTTCATGGGCTTCAGC
>probe:Drosophila_2:1630742_at:711:523; Interrogation_Position=1617; Antisense; GGGCTTCAGCATTTTTTCGGTGATC
>probe:Drosophila_2:1630742_at:291:145; Interrogation_Position=1764; Antisense; ACTGCGTCGCAATCGAGGTGGTCTC
>probe:Drosophila_2:1630742_at:240:85; Interrogation_Position=1816; Antisense; AGTGATCTGCAAAAGTTCCGCGGGA
>probe:Drosophila_2:1630742_at:324:179; Interrogation_Position=1870; Antisense; AAACTTTGGCGGACGCTGCAAGTGC

Paste this into a BLAST search page for me
GCTTCGATCGTTTCGGATCCACGATGATCCACGATTTCAGGCCGGCGAGAGGCCGGCGAGAATCTACCCGAATATCGAATATATCTTCCACGGGCCATATATAGCAATGCCAGCGAGATTTCGATTGCACTTCTACTACATGACCAACATATGACCAACATATTTCGCAGCACCAAGTCCGAGATGTTTGGCTTTACCGAAATTTCCAGCTAATACGGGCGGCCTTTTGGGACTTTTCATGGGCTTCAGCGGGCTTCAGCATTTTTTCGGTGATCACTGCGTCGCAATCGAGGTGGTCTCAGTGATCTGCAAAAGTTCCGCGGGAAAACTTTGGCGGACGCTGCAAGTGC

Full Affymetrix probeset data:

Annotations for 1630742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720