FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630743_at:

>probe:Drosophila_2:1630743_at:571:171; Interrogation_Position=1556; Antisense; AAAGAGGCGTCGCTCTTCAGACAAC
>probe:Drosophila_2:1630743_at:430:349; Interrogation_Position=1604; Antisense; GCAGGAAATACCTACGTCGCCCATT
>probe:Drosophila_2:1630743_at:535:501; Interrogation_Position=1619; Antisense; GTCGCCCATTGCAAAGATAACCAAG
>probe:Drosophila_2:1630743_at:701:213; Interrogation_Position=1667; Antisense; AAGAGTCGTCCTAGAGTCTTCTTCT
>probe:Drosophila_2:1630743_at:541:245; Interrogation_Position=1693; Antisense; AATTAGATAGCACTGCCCAGCAGGA
>probe:Drosophila_2:1630743_at:678:557; Interrogation_Position=1723; Antisense; GGACTTCAGCGACCTCTAATGACAG
>probe:Drosophila_2:1630743_at:9:657; Interrogation_Position=1739; Antisense; TAATGACAGCTCTCCTGTCCAACAG
>probe:Drosophila_2:1630743_at:85:207; Interrogation_Position=1774; Antisense; AAGCGTACATCTCGTGCTACATTTG
>probe:Drosophila_2:1630743_at:127:695; Interrogation_Position=1795; Antisense; TTTGCGGCAGATCCTTTGACTTAAA
>probe:Drosophila_2:1630743_at:564:483; Interrogation_Position=1859; Antisense; GTATCGTTTCTAGCGTATAGCCATT
>probe:Drosophila_2:1630743_at:130:509; Interrogation_Position=1925; Antisense; GTGCATCTTATCATTTTCCACTGGC
>probe:Drosophila_2:1630743_at:240:259; Interrogation_Position=1943; Antisense; CACTGGCCTGCCAAATGCAAACGTT
>probe:Drosophila_2:1630743_at:244:677; Interrogation_Position=2049; Antisense; TAGAAACCATTTTGCATTTGCCTTT
>probe:Drosophila_2:1630743_at:481:17; Interrogation_Position=2064; Antisense; ATTTGCCTTTTATCCATACAGAGTT

Paste this into a BLAST search page for me
AAAGAGGCGTCGCTCTTCAGACAACGCAGGAAATACCTACGTCGCCCATTGTCGCCCATTGCAAAGATAACCAAGAAGAGTCGTCCTAGAGTCTTCTTCTAATTAGATAGCACTGCCCAGCAGGAGGACTTCAGCGACCTCTAATGACAGTAATGACAGCTCTCCTGTCCAACAGAAGCGTACATCTCGTGCTACATTTGTTTGCGGCAGATCCTTTGACTTAAAGTATCGTTTCTAGCGTATAGCCATTGTGCATCTTATCATTTTCCACTGGCCACTGGCCTGCCAAATGCAAACGTTTAGAAACCATTTTGCATTTGCCTTTATTTGCCTTTTATCCATACAGAGTT

Full Affymetrix probeset data:

Annotations for 1630743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720