Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630745_at:

>probe:Drosophila_2:1630745_at:318:495; Interrogation_Position=149; Antisense; GTCACCTATCCGATCCAGATGAAGT
>probe:Drosophila_2:1630745_at:306:55; Interrogation_Position=167; Antisense; ATGAAGTACTGTGGCCACTGCACGA
>probe:Drosophila_2:1630745_at:295:293; Interrogation_Position=189; Antisense; CGATGCCCATTGAGTACTGCGAGTA
>probe:Drosophila_2:1630745_at:275:225; Interrogation_Position=236; Antisense; AAGGAGTGGCTGGAGCTCCACATGC
>probe:Drosophila_2:1630745_at:50:51; Interrogation_Position=257; Antisense; ATGCCCGATGACTTCGAGCGACTAA
>probe:Drosophila_2:1630745_at:677:361; Interrogation_Position=348; Antisense; GCAAGGGACTGTTGCGCGTCAAGAA
>probe:Drosophila_2:1630745_at:296:75; Interrogation_Position=378; Antisense; AGGACGTGCCCAAGCGTATCTGCGT
>probe:Drosophila_2:1630745_at:245:413; Interrogation_Position=436; Antisense; GACCGTGGTCACAGGATTGAGCACT
>probe:Drosophila_2:1630745_at:206:21; Interrogation_Position=465; Antisense; ATATTGATCTCAAGGTGGCCGCCAA
>probe:Drosophila_2:1630745_at:536:581; Interrogation_Position=480; Antisense; TGGCCGCCAAGTTCTTTGGCACGAA
>probe:Drosophila_2:1630745_at:114:729; Interrogation_Position=495; Antisense; TTGGCACGAAATTTGCCTGCGGCTC
>probe:Drosophila_2:1630745_at:192:285; Interrogation_Position=522; Antisense; CGGTTACCGGAGACGACGAGATCGT
>probe:Drosophila_2:1630745_at:305:611; Interrogation_Position=568; Antisense; TGACTTGTTCGATGTCATACCCGAA
>probe:Drosophila_2:1630745_at:657:341; Interrogation_Position=673; Antisense; GCTTATTTTATACGCTCCATCAACA

Paste this into a BLAST search page for me
GTCACCTATCCGATCCAGATGAAGTATGAAGTACTGTGGCCACTGCACGACGATGCCCATTGAGTACTGCGAGTAAAGGAGTGGCTGGAGCTCCACATGCATGCCCGATGACTTCGAGCGACTAAGCAAGGGACTGTTGCGCGTCAAGAAAGGACGTGCCCAAGCGTATCTGCGTGACCGTGGTCACAGGATTGAGCACTATATTGATCTCAAGGTGGCCGCCAATGGCCGCCAAGTTCTTTGGCACGAATTGGCACGAAATTTGCCTGCGGCTCCGGTTACCGGAGACGACGAGATCGTTGACTTGTTCGATGTCATACCCGAAGCTTATTTTATACGCTCCATCAACA

Full Affymetrix probeset data:

Annotations for 1630745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime