FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630746_at:

>probe:Drosophila_2:1630746_at:446:625; Interrogation_Position=14; Antisense; TGCCCAATAACAAAGCCCAGACTCG
>probe:Drosophila_2:1630746_at:302:549; Interrogation_Position=168; Antisense; GGAGGAACTCAAGCTATATTACCAA
>probe:Drosophila_2:1630746_at:340:213; Interrogation_Position=227; Antisense; AAGAGCAGTTGTTGTTCGAGTCCAA
>probe:Drosophila_2:1630746_at:620:555; Interrogation_Position=252; Antisense; GGACGAATTAACACAGCAGCTTGAG
>probe:Drosophila_2:1630746_at:575:463; Interrogation_Position=279; Antisense; GATTGCCATCGAAAATACTTGCTGC
>probe:Drosophila_2:1630746_at:552:301; Interrogation_Position=29; Antisense; CCCAGACTCGCTCGTTGATGAGGAT
>probe:Drosophila_2:1630746_at:726:283; Interrogation_Position=300; Antisense; CTGCATATGCCTGGATCCTTGGGAA
>probe:Drosophila_2:1630746_at:614:371; Interrogation_Position=327; Antisense; GAAGGATCATCACCGCTTGGTTTCG
>probe:Drosophila_2:1630746_at:278:479; Interrogation_Position=346; Antisense; GTTTCGCTTAGATGTGGTCACCTTT
>probe:Drosophila_2:1630746_at:335:527; Interrogation_Position=374; Antisense; GGGAGATGTGCATCCGGACCCACTT
>probe:Drosophila_2:1630746_at:386:555; Interrogation_Position=389; Antisense; GGACCCACTTGCAGCATGCCGATAT
>probe:Drosophila_2:1630746_at:85:51; Interrogation_Position=404; Antisense; ATGCCGATATGTGCCCAATATGCCG
>probe:Drosophila_2:1630746_at:60:407; Interrogation_Position=448; Antisense; GACGTCTGGCGTGTGTTATTAAACA
>probe:Drosophila_2:1630746_at:16:373; Interrogation_Position=60; Antisense; GAAGGATGTTGTTGAGCAGCTCTTA

Paste this into a BLAST search page for me
TGCCCAATAACAAAGCCCAGACTCGGGAGGAACTCAAGCTATATTACCAAAAGAGCAGTTGTTGTTCGAGTCCAAGGACGAATTAACACAGCAGCTTGAGGATTGCCATCGAAAATACTTGCTGCCCCAGACTCGCTCGTTGATGAGGATCTGCATATGCCTGGATCCTTGGGAAGAAGGATCATCACCGCTTGGTTTCGGTTTCGCTTAGATGTGGTCACCTTTGGGAGATGTGCATCCGGACCCACTTGGACCCACTTGCAGCATGCCGATATATGCCGATATGTGCCCAATATGCCGGACGTCTGGCGTGTGTTATTAAACAGAAGGATGTTGTTGAGCAGCTCTTA

Full Affymetrix probeset data:

Annotations for 1630746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720