FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630749_at:

>probe:Drosophila_2:1630749_at:716:321; Interrogation_Position=107; Antisense; GCGAGGAGCCCAACCGAATTTCGAA
>probe:Drosophila_2:1630749_at:232:611; Interrogation_Position=14; Antisense; TGACCTCCCAAGAAACGCAGACTGA
>probe:Drosophila_2:1630749_at:484:287; Interrogation_Position=158; Antisense; CGGACAGAAGCGATGAGCCGGTCTT
>probe:Drosophila_2:1630749_at:254:713; Interrogation_Position=181; Antisense; TTCAGCTGCCAATTCGAAGTGTTCG
>probe:Drosophila_2:1630749_at:103:641; Interrogation_Position=203; Antisense; TCGGCATTGTGCAAGGCGTTTCATT
>probe:Drosophila_2:1630749_at:114:367; Interrogation_Position=230; Antisense; GAATGTACACCTTGCGAAGAGCTCA
>probe:Drosophila_2:1630749_at:584:395; Interrogation_Position=310; Antisense; GAAATTCAAGCACACCGACATTCCT
>probe:Drosophila_2:1630749_at:308:131; Interrogation_Position=323; Antisense; ACCGACATTCCTTTGAGTCCATGCG
>probe:Drosophila_2:1630749_at:304:87; Interrogation_Position=338; Antisense; AGTCCATGCGCCTCTGGCTAAAGCA
>probe:Drosophila_2:1630749_at:667:123; Interrogation_Position=370; Antisense; AGCCCCACCAGTCGAATTGACAAAT
>probe:Drosophila_2:1630749_at:706:397; Interrogation_Position=388; Antisense; GACAAATGCATTTTCAGTGAGACTA
>probe:Drosophila_2:1630749_at:494:363; Interrogation_Position=424; Antisense; GAATTCACGTTCACTAACTTCTCCA
>probe:Drosophila_2:1630749_at:476:1; Interrogation_Position=49; Antisense; AGGAGGGTAACTCTTCCATCTTCGA
>probe:Drosophila_2:1630749_at:64:365; Interrogation_Position=502; Antisense; GAATTTTTCTTACACACACTTATAC

Paste this into a BLAST search page for me
GCGAGGAGCCCAACCGAATTTCGAATGACCTCCCAAGAAACGCAGACTGACGGACAGAAGCGATGAGCCGGTCTTTTCAGCTGCCAATTCGAAGTGTTCGTCGGCATTGTGCAAGGCGTTTCATTGAATGTACACCTTGCGAAGAGCTCAGAAATTCAAGCACACCGACATTCCTACCGACATTCCTTTGAGTCCATGCGAGTCCATGCGCCTCTGGCTAAAGCAAGCCCCACCAGTCGAATTGACAAATGACAAATGCATTTTCAGTGAGACTAGAATTCACGTTCACTAACTTCTCCAAGGAGGGTAACTCTTCCATCTTCGAGAATTTTTCTTACACACACTTATAC

Full Affymetrix probeset data:

Annotations for 1630749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720