Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630750_at:

>probe:Drosophila_2:1630750_at:268:425; Interrogation_Position=183; Antisense; GAGATGCACTTGTGTGCGGCCAAGT
>probe:Drosophila_2:1630750_at:545:219; Interrogation_Position=204; Antisense; AAGTGCTGCCAGGATGGAACCTCCA
>probe:Drosophila_2:1630750_at:155:443; Interrogation_Position=247; Antisense; GATGTGTGGATCGATGCTCCGCGCC
>probe:Drosophila_2:1630750_at:431:247; Interrogation_Position=304; Antisense; AATTGGGCGAGTTCCAGGGCAGACT
>probe:Drosophila_2:1630750_at:74:83; Interrogation_Position=319; Antisense; AGGGCAGACTTCAACGTTGCGTCAT
>probe:Drosophila_2:1630750_at:410:95; Interrogation_Position=397; Antisense; AGATAGCCAAGTACACCGACCAATT
>probe:Drosophila_2:1630750_at:708:123; Interrogation_Position=424; Antisense; AGCGCTGTGCCATCCAGTGTGTGGA
>probe:Drosophila_2:1630750_at:320:519; Interrogation_Position=444; Antisense; GTGGACAAGCATGTGGGCCTCATTC
>probe:Drosophila_2:1630750_at:476:53; Interrogation_Position=486; Antisense; ATGAAGGCTGTGCTCTCCAAGGGAC
>probe:Drosophila_2:1630750_at:494:425; Interrogation_Position=513; Antisense; GAGAGCATTCCCCAAGTCTAACTCA
>probe:Drosophila_2:1630750_at:569:495; Interrogation_Position=528; Antisense; GTCTAACTCAACCTGCATTTACTAC
>probe:Drosophila_2:1630750_at:105:183; Interrogation_Position=581; Antisense; AAAACCGTGCAATGAGTCCCATCTC
>probe:Drosophila_2:1630750_at:547:503; Interrogation_Position=596; Antisense; GTCCCATCTCTGGAGTCATTTCAAA
>probe:Drosophila_2:1630750_at:260:369; Interrogation_Position=715; Antisense; GAATGTCAAGTTTTGCCATCAGTAA

Paste this into a BLAST search page for me
GAGATGCACTTGTGTGCGGCCAAGTAAGTGCTGCCAGGATGGAACCTCCAGATGTGTGGATCGATGCTCCGCGCCAATTGGGCGAGTTCCAGGGCAGACTAGGGCAGACTTCAACGTTGCGTCATAGATAGCCAAGTACACCGACCAATTAGCGCTGTGCCATCCAGTGTGTGGAGTGGACAAGCATGTGGGCCTCATTCATGAAGGCTGTGCTCTCCAAGGGACGAGAGCATTCCCCAAGTCTAACTCAGTCTAACTCAACCTGCATTTACTACAAAACCGTGCAATGAGTCCCATCTCGTCCCATCTCTGGAGTCATTTCAAAGAATGTCAAGTTTTGCCATCAGTAA

Full Affymetrix probeset data:

Annotations for 1630750_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime