FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630753_at:

>probe:Drosophila_2:1630753_at:7:205; Interrogation_Position=1839; Antisense; AAGCCACAAATGTATTGCGGGATCT
>probe:Drosophila_2:1630753_at:369:623; Interrogation_Position=1854; Antisense; TGCGGGATCTGCTATGGCACAACTT
>probe:Drosophila_2:1630753_at:660:565; Interrogation_Position=1869; Antisense; GGCACAACTTCCAAATAGCTACCAA
>probe:Drosophila_2:1630753_at:369:423; Interrogation_Position=2011; Antisense; GAGAACATCTCATTATAACCTACAA
>probe:Drosophila_2:1630753_at:379:49; Interrogation_Position=2053; Antisense; ATCCAATCTGGCTTTGATTTCAGTG
>probe:Drosophila_2:1630753_at:507:451; Interrogation_Position=2077; Antisense; GATCAGCTTTTGTCTAAATGCCATT
>probe:Drosophila_2:1630753_at:388:9; Interrogation_Position=2149; Antisense; ATTCGTAGATAAGTTCGGTCTCCCA
>probe:Drosophila_2:1630753_at:122:715; Interrogation_Position=2162; Antisense; TTCGGTCTCCCAACTTTTACAGAAT
>probe:Drosophila_2:1630753_at:524:213; Interrogation_Position=2225; Antisense; AAGTTATTACGCACTTCGTTGTTAT
>probe:Drosophila_2:1630753_at:381:465; Interrogation_Position=2242; Antisense; GTTGTTATTTTGTTGTCCCGTGAAT
>probe:Drosophila_2:1630753_at:537:503; Interrogation_Position=2256; Antisense; GTCCCGTGAATTGTTCGCACTTTTA
>probe:Drosophila_2:1630753_at:543:171; Interrogation_Position=2280; Antisense; AAAGTTGATACCATGGCATCCCATA
>probe:Drosophila_2:1630753_at:332:569; Interrogation_Position=2294; Antisense; GGCATCCCATAACGTACGGCTTGAA
>probe:Drosophila_2:1630753_at:397:241; Interrogation_Position=2405; Antisense; AATACACGCCCACACTATAGGACAA

Paste this into a BLAST search page for me
AAGCCACAAATGTATTGCGGGATCTTGCGGGATCTGCTATGGCACAACTTGGCACAACTTCCAAATAGCTACCAAGAGAACATCTCATTATAACCTACAAATCCAATCTGGCTTTGATTTCAGTGGATCAGCTTTTGTCTAAATGCCATTATTCGTAGATAAGTTCGGTCTCCCATTCGGTCTCCCAACTTTTACAGAATAAGTTATTACGCACTTCGTTGTTATGTTGTTATTTTGTTGTCCCGTGAATGTCCCGTGAATTGTTCGCACTTTTAAAAGTTGATACCATGGCATCCCATAGGCATCCCATAACGTACGGCTTGAAAATACACGCCCACACTATAGGACAA

Full Affymetrix probeset data:

Annotations for 1630753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720