Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630754_at:

>probe:Drosophila_2:1630754_at:123:535; Interrogation_Position=111; Antisense; GGTGCACCTGCTCTTCTTATCAGTG
>probe:Drosophila_2:1630754_at:322:703; Interrogation_Position=127; Antisense; TTATCAGTGCCCTTCGTTAGCATTC
>probe:Drosophila_2:1630754_at:715:53; Interrogation_Position=13; Antisense; ATGACGTCCATTGCGGGAGGCCACG
>probe:Drosophila_2:1630754_at:447:475; Interrogation_Position=142; Antisense; GTTAGCATTCCATGGGCCTGGACGG
>probe:Drosophila_2:1630754_at:148:149; Interrogation_Position=200; Antisense; ACTTTCTGCACGTCATCAAGGGCGC
>probe:Drosophila_2:1630754_at:250:421; Interrogation_Position=241; Antisense; GAGAACGATCCCAGCCGGCGTTGGA
>probe:Drosophila_2:1630754_at:264:491; Interrogation_Position=292; Antisense; GTACAGATGACCACAACGCGCAAGT
>probe:Drosophila_2:1630754_at:143:201; Interrogation_Position=306; Antisense; AACGCGCAAGTTCCTCACAGCTGTT
>probe:Drosophila_2:1630754_at:96:273; Interrogation_Position=333; Antisense; CATTGTTCTTTTCCTACTTACCTGT
>probe:Drosophila_2:1630754_at:682:705; Interrogation_Position=350; Antisense; TTACCTGTCTGTACACCCGAAACAA
>probe:Drosophila_2:1630754_at:458:189; Interrogation_Position=394; Antisense; AACTTTATATCCCTGGTGGTCGTCA
>probe:Drosophila_2:1630754_at:691:69; Interrogation_Position=41; Antisense; AGGCGAATCCAAACAGCTCCTGGCT
>probe:Drosophila_2:1630754_at:523:141; Interrogation_Position=443; Antisense; ACGGCGTGCGGCTGTTCAACATTAA
>probe:Drosophila_2:1630754_at:328:461; Interrogation_Position=77; Antisense; GATTTTGGCTAGCATACCTCCTGGG

Paste this into a BLAST search page for me
GGTGCACCTGCTCTTCTTATCAGTGTTATCAGTGCCCTTCGTTAGCATTCATGACGTCCATTGCGGGAGGCCACGGTTAGCATTCCATGGGCCTGGACGGACTTTCTGCACGTCATCAAGGGCGCGAGAACGATCCCAGCCGGCGTTGGAGTACAGATGACCACAACGCGCAAGTAACGCGCAAGTTCCTCACAGCTGTTCATTGTTCTTTTCCTACTTACCTGTTTACCTGTCTGTACACCCGAAACAAAACTTTATATCCCTGGTGGTCGTCAAGGCGAATCCAAACAGCTCCTGGCTACGGCGTGCGGCTGTTCAACATTAAGATTTTGGCTAGCATACCTCCTGGG

Full Affymetrix probeset data:

Annotations for 1630754_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime