FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630755_at:

>probe:Drosophila_2:1630755_at:400:533; Interrogation_Position=1132; Antisense; GGTGTAGCCACAAGCAGGGTCCTCT
>probe:Drosophila_2:1630755_at:439:643; Interrogation_Position=1154; Antisense; TCTCTTCACGCTGGGAGGGCACAAG
>probe:Drosophila_2:1630755_at:28:571; Interrogation_Position=1182; Antisense; GGCATCACACAACTGCGCTATGGAG
>probe:Drosophila_2:1630755_at:230:347; Interrogation_Position=1226; Antisense; GCATCTGTTCAGTGGAGCTCGCAAG
>probe:Drosophila_2:1630755_at:33:617; Interrogation_Position=1264; Antisense; TGCAGTGGGACATGCGCAACTACAA
>probe:Drosophila_2:1630755_at:89:313; Interrogation_Position=1292; Antisense; GCCACTGGTGGAGTTGCAGCGCCAT
>probe:Drosophila_2:1630755_at:473:63; Interrogation_Position=1315; Antisense; ATGTGGACACCAATCAGCGTATTCA
>probe:Drosophila_2:1630755_at:20:123; Interrogation_Position=1330; Antisense; AGCGTATTCAATTCGACCTCGCATC
>probe:Drosophila_2:1630755_at:66:249; Interrogation_Position=1362; Antisense; AATTGGCTGGCTAGCGGTGACACAC
>probe:Drosophila_2:1630755_at:342:713; Interrogation_Position=1448; Antisense; TTCAGACTGCTGCAACGGAGTGGCA
>probe:Drosophila_2:1630755_at:377:549; Interrogation_Position=1464; Antisense; GGAGTGGCACTCAATCCGGCTATGC
>probe:Drosophila_2:1630755_at:190:525; Interrogation_Position=1509; Antisense; GGGCAGTTCCACTTTACAGACCAAA
>probe:Drosophila_2:1630755_at:215:577; Interrogation_Position=1586; Antisense; GGCGCCGGCCGATGTGAATCAAAAT
>probe:Drosophila_2:1630755_at:237:713; Interrogation_Position=1621; Antisense; TTCTCTACGAGAACGCAGTGGTCAT

Paste this into a BLAST search page for me
GGTGTAGCCACAAGCAGGGTCCTCTTCTCTTCACGCTGGGAGGGCACAAGGGCATCACACAACTGCGCTATGGAGGCATCTGTTCAGTGGAGCTCGCAAGTGCAGTGGGACATGCGCAACTACAAGCCACTGGTGGAGTTGCAGCGCCATATGTGGACACCAATCAGCGTATTCAAGCGTATTCAATTCGACCTCGCATCAATTGGCTGGCTAGCGGTGACACACTTCAGACTGCTGCAACGGAGTGGCAGGAGTGGCACTCAATCCGGCTATGCGGGCAGTTCCACTTTACAGACCAAAGGCGCCGGCCGATGTGAATCAAAATTTCTCTACGAGAACGCAGTGGTCAT

Full Affymetrix probeset data:

Annotations for 1630755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720