Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630756_at:

>probe:Drosophila_2:1630756_at:469:211; Interrogation_Position=1795; Antisense; AAGAACTTCGAACAGGAGCGCATGA
>probe:Drosophila_2:1630756_at:312:31; Interrogation_Position=1886; Antisense; ATAAATACCCTGGAAGGCGCTCGAA
>probe:Drosophila_2:1630756_at:441:227; Interrogation_Position=1899; Antisense; AAGGCGCTCGAAATGCTGTTAAGAT
>probe:Drosophila_2:1630756_at:422:673; Interrogation_Position=1932; Antisense; TATCTCTTGGGTTACATTTCTTTTG
>probe:Drosophila_2:1630756_at:691:689; Interrogation_Position=1958; Antisense; TATTCGGTTAATCATGCTATACGCA
>probe:Drosophila_2:1630756_at:213:339; Interrogation_Position=1973; Antisense; GCTATACGCATAGCCTAATCCTTAT
>probe:Drosophila_2:1630756_at:205:657; Interrogation_Position=1988; Antisense; TAATCCTTATCCCAACGCCAAATGG
>probe:Drosophila_2:1630756_at:372:169; Interrogation_Position=2007; Antisense; AAATGGCAACGCATACTGTACATAT
>probe:Drosophila_2:1630756_at:671:249; Interrogation_Position=2107; Antisense; CAATCGTAGTTGTAGTATGCCTCTA
>probe:Drosophila_2:1630756_at:131:485; Interrogation_Position=2121; Antisense; GTATGCCTCTATTCTAATCGATCCT
>probe:Drosophila_2:1630756_at:174:391; Interrogation_Position=2159; Antisense; GAAACGTTCGTTGTGCTAACTTGTG
>probe:Drosophila_2:1630756_at:687:489; Interrogation_Position=2266; Antisense; GTACATAACACTTACGACCTTAATT
>probe:Drosophila_2:1630756_at:618:595; Interrogation_Position=2296; Antisense; TGTCTAATTTTGTTTGTCCTGTCGG
>probe:Drosophila_2:1630756_at:646:691; Interrogation_Position=2308; Antisense; TTTGTCCTGTCGGAAAGCCCAACAA

Paste this into a BLAST search page for me
AAGAACTTCGAACAGGAGCGCATGAATAAATACCCTGGAAGGCGCTCGAAAAGGCGCTCGAAATGCTGTTAAGATTATCTCTTGGGTTACATTTCTTTTGTATTCGGTTAATCATGCTATACGCAGCTATACGCATAGCCTAATCCTTATTAATCCTTATCCCAACGCCAAATGGAAATGGCAACGCATACTGTACATATCAATCGTAGTTGTAGTATGCCTCTAGTATGCCTCTATTCTAATCGATCCTGAAACGTTCGTTGTGCTAACTTGTGGTACATAACACTTACGACCTTAATTTGTCTAATTTTGTTTGTCCTGTCGGTTTGTCCTGTCGGAAAGCCCAACAA

Full Affymetrix probeset data:

Annotations for 1630756_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime