FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630761_at:

>probe:Drosophila_2:1630761_at:136:647; Interrogation_Position=416; Antisense; TCATTCTGCCCATCACCGGAAATGG
>probe:Drosophila_2:1630761_at:284:7; Interrogation_Position=442; Antisense; ATTGCTGACATACGCCTCACTAGAA
>probe:Drosophila_2:1630761_at:680:385; Interrogation_Position=464; Antisense; GAACAAAGGTACGTGCACAGATCAA
>probe:Drosophila_2:1630761_at:371:243; Interrogation_Position=488; Antisense; AATTGAAGCGCGTCTCCAAGGGCGA
>probe:Drosophila_2:1630761_at:111:453; Interrogation_Position=511; Antisense; GATCATCAAACCTACGCCGAGGTGA
>probe:Drosophila_2:1630761_at:146:171; Interrogation_Position=543; Antisense; AAAGGTTGAGCTGGATCCATCCCAT
>probe:Drosophila_2:1630761_at:701:511; Interrogation_Position=568; Antisense; GTGACCTACCAGCTGGAAAATCTGT
>probe:Drosophila_2:1630761_at:59:473; Interrogation_Position=591; Antisense; GTTCAACGGCCAGAAAGATCTCAGC
>probe:Drosophila_2:1630761_at:267:453; Interrogation_Position=607; Antisense; GATCTCAGCGAGAACATGCACGCGC
>probe:Drosophila_2:1630761_at:482:53; Interrogation_Position=622; Antisense; ATGCACGCGCTTATCAATGAGAACT
>probe:Drosophila_2:1630761_at:162:613; Interrogation_Position=668; Antisense; TGAAACCGGGCATTGGCGAGGCCTT
>probe:Drosophila_2:1630761_at:635:439; Interrogation_Position=685; Antisense; GAGGCCTTCGGACTGATAGCCAAGT
>probe:Drosophila_2:1630761_at:6:453; Interrogation_Position=723; Antisense; GATCTTTGGCAAACTGCCGCTCGAA
>probe:Drosophila_2:1630761_at:249:299; Interrogation_Position=740; Antisense; CGCTCGAACAGCTCTTTGTAGTCTA

Paste this into a BLAST search page for me
TCATTCTGCCCATCACCGGAAATGGATTGCTGACATACGCCTCACTAGAAGAACAAAGGTACGTGCACAGATCAAAATTGAAGCGCGTCTCCAAGGGCGAGATCATCAAACCTACGCCGAGGTGAAAAGGTTGAGCTGGATCCATCCCATGTGACCTACCAGCTGGAAAATCTGTGTTCAACGGCCAGAAAGATCTCAGCGATCTCAGCGAGAACATGCACGCGCATGCACGCGCTTATCAATGAGAACTTGAAACCGGGCATTGGCGAGGCCTTGAGGCCTTCGGACTGATAGCCAAGTGATCTTTGGCAAACTGCCGCTCGAACGCTCGAACAGCTCTTTGTAGTCTA

Full Affymetrix probeset data:

Annotations for 1630761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720