FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630762_at:

>probe:Drosophila_2:1630762_at:610:345; Interrogation_Position=1034; Antisense; GCATCAACCCGCTGTTATATAACAT
>probe:Drosophila_2:1630762_at:392:471; Interrogation_Position=1071; Antisense; GTTCCGAGAGGCATTCAAGGCCGTT
>probe:Drosophila_2:1630762_at:534:653; Interrogation_Position=1085; Antisense; TCAAGGCCGTTCTGTTTGGCAAGAA
>probe:Drosophila_2:1630762_at:719:433; Interrogation_Position=1164; Antisense; GAGGGCACTAACCAATTCCAGTCAA
>probe:Drosophila_2:1630762_at:454:247; Interrogation_Position=1177; Antisense; AATTCCAGTCAAACGCAGCGCTTCT
>probe:Drosophila_2:1630762_at:687:321; Interrogation_Position=1194; Antisense; GCGCTTCTCCATTGAGTCGGCGGAG
>probe:Drosophila_2:1630762_at:391:553; Interrogation_Position=1215; Antisense; GGAGCAGCCGAAACCGTCGATAATG
>probe:Drosophila_2:1630762_at:409:687; Interrogation_Position=716; Antisense; TATATCGCTATGGTGGATCCGGTAC
>probe:Drosophila_2:1630762_at:465:447; Interrogation_Position=731; Antisense; GATCCGGTACCGCTATGAGTTTCAA
>probe:Drosophila_2:1630762_at:344:147; Interrogation_Position=810; Antisense; ACTTAGCTCGGTGAGAGGTCGGCTC
>probe:Drosophila_2:1630762_at:383:65; Interrogation_Position=842; Antisense; ATGGCACCCGGCGAGTACTCAGGAT
>probe:Drosophila_2:1630762_at:502:667; Interrogation_Position=857; Antisense; TACTCAGGATGCTAGTGGCCGTGGT
>probe:Drosophila_2:1630762_at:560:529; Interrogation_Position=965; Antisense; GGGATCAGCACGAGTTTGTCTACAC
>probe:Drosophila_2:1630762_at:689:531; Interrogation_Position=990; Antisense; GGTGATGACCTATGTCTCCGGTGTC

Paste this into a BLAST search page for me
GCATCAACCCGCTGTTATATAACATGTTCCGAGAGGCATTCAAGGCCGTTTCAAGGCCGTTCTGTTTGGCAAGAAGAGGGCACTAACCAATTCCAGTCAAAATTCCAGTCAAACGCAGCGCTTCTGCGCTTCTCCATTGAGTCGGCGGAGGGAGCAGCCGAAACCGTCGATAATGTATATCGCTATGGTGGATCCGGTACGATCCGGTACCGCTATGAGTTTCAAACTTAGCTCGGTGAGAGGTCGGCTCATGGCACCCGGCGAGTACTCAGGATTACTCAGGATGCTAGTGGCCGTGGTGGGATCAGCACGAGTTTGTCTACACGGTGATGACCTATGTCTCCGGTGTC

Full Affymetrix probeset data:

Annotations for 1630762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720