FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630763_at:

>probe:Drosophila_2:1630763_at:58:581; Interrogation_Position=1629; Antisense; TGGCCGAGCCGTATATTTTGCGTAC
>probe:Drosophila_2:1630763_at:307:723; Interrogation_Position=1646; Antisense; TTGCGTACTCGCCATCTTATAATGG
>probe:Drosophila_2:1630763_at:566:63; Interrogation_Position=1667; Antisense; ATGGCCCACTTTTATCCAAAACGCG
>probe:Drosophila_2:1630763_at:441:343; Interrogation_Position=1743; Antisense; GCATTTTTAAGTTTATCCGCCGCAG
>probe:Drosophila_2:1630763_at:257:677; Interrogation_Position=1834; Antisense; TAGATTCTCCTGTTTAATGTGCATG
>probe:Drosophila_2:1630763_at:246:711; Interrogation_Position=1847; Antisense; TTAATGTGCATGTGCTCCTGCTGCT
>probe:Drosophila_2:1630763_at:526:335; Interrogation_Position=1866; Antisense; GCTGCTCATCCTGTCAAAGCACTGA
>probe:Drosophila_2:1630763_at:381:25; Interrogation_Position=1901; Antisense; ATATGTGGCCGATCTCTGACTCTTT
>probe:Drosophila_2:1630763_at:615:609; Interrogation_Position=1917; Antisense; TGACTCTTTCAAATCGTAACCCCTG
>probe:Drosophila_2:1630763_at:429:85; Interrogation_Position=2001; Antisense; AGTGTTGTCTGTGCAATCGACCAGT
>probe:Drosophila_2:1630763_at:477:679; Interrogation_Position=2030; Antisense; TATGGTGATTTTTCCGACGTTACTG
>probe:Drosophila_2:1630763_at:511:409; Interrogation_Position=2060; Antisense; GACGACTCTTCGGACTATTCTGAAA
>probe:Drosophila_2:1630763_at:207:413; Interrogation_Position=2116; Antisense; GACCTGTGGAGGACAACGCTAGCAA
>probe:Drosophila_2:1630763_at:501:27; Interrogation_Position=2178; Antisense; ATACACGTTATGCAGATAGCTCAGA

Paste this into a BLAST search page for me
TGGCCGAGCCGTATATTTTGCGTACTTGCGTACTCGCCATCTTATAATGGATGGCCCACTTTTATCCAAAACGCGGCATTTTTAAGTTTATCCGCCGCAGTAGATTCTCCTGTTTAATGTGCATGTTAATGTGCATGTGCTCCTGCTGCTGCTGCTCATCCTGTCAAAGCACTGAATATGTGGCCGATCTCTGACTCTTTTGACTCTTTCAAATCGTAACCCCTGAGTGTTGTCTGTGCAATCGACCAGTTATGGTGATTTTTCCGACGTTACTGGACGACTCTTCGGACTATTCTGAAAGACCTGTGGAGGACAACGCTAGCAAATACACGTTATGCAGATAGCTCAGA

Full Affymetrix probeset data:

Annotations for 1630763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720