Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630764_at:

>probe:Drosophila_2:1630764_at:114:485; Interrogation_Position=5230; Antisense; GTATGCCTAGACACAGACAGAGACC
>probe:Drosophila_2:1630764_at:613:399; Interrogation_Position=5245; Antisense; GACAGAGACCAAGTCCACATCCAGA
>probe:Drosophila_2:1630764_at:351:153; Interrogation_Position=5261; Antisense; ACATCCAGACTGGTGACAGCTGTGC
>probe:Drosophila_2:1630764_at:392:261; Interrogation_Position=5277; Antisense; CAGCTGTGCGATGTTTTTCTTAGTT
>probe:Drosophila_2:1630764_at:468:721; Interrogation_Position=5300; Antisense; TTGTTTAAGCGCGAACCGTTTGAAT
>probe:Drosophila_2:1630764_at:75:53; Interrogation_Position=5349; Antisense; ATGAATGTTAATCTTAGCCCTCCCT
>probe:Drosophila_2:1630764_at:384:665; Interrogation_Position=5480; Antisense; TACAATAGGTCTATCCGGCGTTGCC
>probe:Drosophila_2:1630764_at:429:625; Interrogation_Position=5501; Antisense; TGCCCTACAGCCGAATAACCATGAT
>probe:Drosophila_2:1630764_at:75:443; Interrogation_Position=5523; Antisense; GATGAAACGAACCTACGAACCGCTT
>probe:Drosophila_2:1630764_at:706:671; Interrogation_Position=5536; Antisense; TACGAACCGCTTGGCACAGGAACGA
>probe:Drosophila_2:1630764_at:278:391; Interrogation_Position=5559; Antisense; GAAACGCAGTCAGCAGATTCCTTTA
>probe:Drosophila_2:1630764_at:196:345; Interrogation_Position=5571; Antisense; GCAGATTCCTTTAGTACCTTTTTCG
>probe:Drosophila_2:1630764_at:326:105; Interrogation_Position=5683; Antisense; AGACTTGCGTGTTATCTGAATCAAA
>probe:Drosophila_2:1630764_at:27:439; Interrogation_Position=5725; Antisense; GATGCAACCAACCAACTTTGTAGTG

Paste this into a BLAST search page for me
GTATGCCTAGACACAGACAGAGACCGACAGAGACCAAGTCCACATCCAGAACATCCAGACTGGTGACAGCTGTGCCAGCTGTGCGATGTTTTTCTTAGTTTTGTTTAAGCGCGAACCGTTTGAATATGAATGTTAATCTTAGCCCTCCCTTACAATAGGTCTATCCGGCGTTGCCTGCCCTACAGCCGAATAACCATGATGATGAAACGAACCTACGAACCGCTTTACGAACCGCTTGGCACAGGAACGAGAAACGCAGTCAGCAGATTCCTTTAGCAGATTCCTTTAGTACCTTTTTCGAGACTTGCGTGTTATCTGAATCAAAGATGCAACCAACCAACTTTGTAGTG

Full Affymetrix probeset data:

Annotations for 1630764_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime