Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630765_at:

>probe:Drosophila_2:1630765_at:378:373; Interrogation_Position=1078; Antisense; GAAGTGTTCATGAAGCTCCACCGCC
>probe:Drosophila_2:1630765_at:362:129; Interrogation_Position=1103; Antisense; ACCAGCTCAAGATGACGAGTCCGAA
>probe:Drosophila_2:1630765_at:480:213; Interrogation_Position=1195; Antisense; AAGAGGCTACTGCTGCGCCTGAAGT
>probe:Drosophila_2:1630765_at:668:283; Interrogation_Position=1213; Antisense; CTGAAGTCCCTGCAGTGGCTGAAGA
>probe:Drosophila_2:1630765_at:507:135; Interrogation_Position=1246; Antisense; ACGCAGCAGAAGCTCCCGCAGAGGA
>probe:Drosophila_2:1630765_at:430:559; Interrogation_Position=692; Antisense; GGACAAATCGCAGCAGACCACCATG
>probe:Drosophila_2:1630765_at:177:57; Interrogation_Position=714; Antisense; ATGACCTATGCTCCGAAGCCAAGTG
>probe:Drosophila_2:1630765_at:360:199; Interrogation_Position=767; Antisense; AACGCAGAGCAGCAGTGCACCCTTG
>probe:Drosophila_2:1630765_at:183:287; Interrogation_Position=836; Antisense; CTGTGTCACCTGTGGAGGCTTCGAA
>probe:Drosophila_2:1630765_at:138:715; Interrogation_Position=855; Antisense; TTCGAAAGATCTCAGCCCGGTATTT
>probe:Drosophila_2:1630765_at:561:279; Interrogation_Position=872; Antisense; CGGTATTTCGGATCTGGACCTTAAT
>probe:Drosophila_2:1630765_at:347:653; Interrogation_Position=893; Antisense; TAATAAGCGCGTAGAACCTCATGAC
>probe:Drosophila_2:1630765_at:439:279; Interrogation_Position=910; Antisense; CTCATGACGAGGAGCCAGTCTGTGT
>probe:Drosophila_2:1630765_at:686:667; Interrogation_Position=969; Antisense; TACGAGGAAATCCAACCGGAGGCTG

Paste this into a BLAST search page for me
GAAGTGTTCATGAAGCTCCACCGCCACCAGCTCAAGATGACGAGTCCGAAAAGAGGCTACTGCTGCGCCTGAAGTCTGAAGTCCCTGCAGTGGCTGAAGAACGCAGCAGAAGCTCCCGCAGAGGAGGACAAATCGCAGCAGACCACCATGATGACCTATGCTCCGAAGCCAAGTGAACGCAGAGCAGCAGTGCACCCTTGCTGTGTCACCTGTGGAGGCTTCGAATTCGAAAGATCTCAGCCCGGTATTTCGGTATTTCGGATCTGGACCTTAATTAATAAGCGCGTAGAACCTCATGACCTCATGACGAGGAGCCAGTCTGTGTTACGAGGAAATCCAACCGGAGGCTG

Full Affymetrix probeset data:

Annotations for 1630765_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime